Molecule Information
General Information of the Molecule (ID: Mol01495)
| Name |
hsa-mir-431
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 431
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR431
|
||||
| Gene ID | |||||
| Location |
chr14:100881007-100881120[+]
|
||||
| Sequence |
UCCUGCUUGUCCUGCGAGGUGUCUUGCAGGCCGUCAUGCAGGCCACACUGACGGUAACGU
UGCAGGUCGUCUUGCAGGGCUUCUCGCAAGACGACAUCCUCAUCACCAACGACG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Adrenocortical carcinoma [ICD-11: 2D11.0] | [1] | |||
| Sensitive Disease | Adrenocortical carcinoma [ICD-11: 2D11.0] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | H295R cells | Kidney | Homo sapiens (Human) | CVCL_0458 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Cell Growth Assay; Flow cytometry assay | |||
| Mechanism Description | Restoration of miR-431 in vitro decreased the half maximal inhibitory concentrations of doxorubicin and mitotane, with markedly increased apoptosis via downregulating ZEB1. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast adenocarcinoma [ICD-11: 2C60.1] | [1] | |||
| Sensitive Disease | Breast adenocarcinoma [ICD-11: 2C60.1] | |||
| Sensitive Drug | Mitotane | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | H295R cells | Kidney | Homo sapiens (Human) | CVCL_0458 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Cell Growth Assay; Flow cytometry assay | |||
| Mechanism Description | Restoration of miR-431 in vitro decreased the half maximal inhibitory concentrations of doxorubicin and mitotane, with markedly increased apoptosis via downregulating ZEB1. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
