Molecule Information
General Information of the Molecule (ID: Mol01495)
Name |
hsa-mir-431
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 431
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR431
|
||||
Gene ID | |||||
Location |
chr14:100881007-100881120[+]
|
||||
Sequence |
UCCUGCUUGUCCUGCGAGGUGUCUUGCAGGCCGUCAUGCAGGCCACACUGACGGUAACGU
UGCAGGUCGUCUUGCAGGGCUUCUCGCAAGACGACAUCCUCAUCACCAACGACG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Adrenocortical carcinoma | [1] | |||
Sensitive Disease | Adrenocortical carcinoma [ICD-11: 2D11.0] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | H295R cells | Kidney | Homo sapiens (Human) | CVCL_0458 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Cell Growth Assay; Flow cytometry assay | |||
Mechanism Description | Restoration of miR-431 in vitro decreased the half maximal inhibitory concentrations of doxorubicin and mitotane, with markedly increased apoptosis via downregulating ZEB1. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast adenocarcinoma | [1] | |||
Sensitive Disease | Breast adenocarcinoma [ICD-11: 2C60.1] | |||
Sensitive Drug | Mitotane | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell migration | Inhibition | hsa04670 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | H295R cells | Kidney | Homo sapiens (Human) | CVCL_0458 |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Cell Growth Assay; Flow cytometry assay | |||
Mechanism Description | Restoration of miR-431 in vitro decreased the half maximal inhibitory concentrations of doxorubicin and mitotane, with markedly increased apoptosis via downregulating ZEB1. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.