Molecule Information
General Information of the Molecule (ID: Mol01489)
Name |
hsa-mir-148b
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 148b
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR148B
|
||||
Gene ID | |||||
Location |
chr12:54337216-54337314[+]
|
||||
Sequence |
CAAGCACGAUUAGCAUUUGAGGUGAAGUUCUGUUAUACACUCAGGCUGUGGCUCUCUGAA
AGUCAGUGCAUCACAGAACUUUGUCUCGAAAGCUUUCUA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Non-small cell lung cancer | [1] | |||
Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
SPC-A1 cells | Lung | Homo sapiens (Human) | CVCL_6955 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | The data showed a down-regulated of miR-148b expression and evaluated methyltransferases (DNMTs) expression in cisplatin-resisted human non-small cell lung cancer (NSCLC) cell line-A549/DDP and SPC-A1/DDP compared with their parental A549 and SPC-A1 cell line. In transfection experiments, miR-148b mimics reduced the DNMT1 expression, as well as (+) the sensitivity of cells to cisplatin and cisplatin-induced apoptosis in A549/DDP or SPC-A1/DDP cells. While miR-148b inhibitor increased DNMT1 expression, as well as attenuated the sensitivity of cells to cisplatin in A549 and SPC-A1 cells. miR-148b was showed to exert negative effect on DNMT1 expression by targeting its 3'UTR in A549/DDP and A549 cells. Importantly, silenced DNMT1 increases cisplatin sensitivity of A549/DDP cells and over-expressed DNMT1 reverses pro-apoptosis effect of miR-148b mimic. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Diffuse large B-cell lymphoma | [2] | |||
Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
Resistant Drug | Cyclophosphamide | |||
Molecule Alteration | Acetylation | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell viability | Activation | hsa05200 | ||
HDAC6/miR148b/Ezrin signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | CRL2631 cells | Bone marrow | Homo sapiens (Human) | CVCL_3611 |
CRL2631/CHOP cells | Bone marrow | Homo sapiens (Human) | CVCL_3611 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | The high level of HDAC6 inhibited miR-148b via maintaining the low acetylation of histones H3 and H4 in the miR-148b promoter, thus rescuing Ezrin expression and promoting CHOP resistance in DLBCL. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Diffuse large B-cell lymphoma | [2] | |||
Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Acetylation | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
HDAC6/miR148b/Ezrin signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | CRL2631 cells | Bone marrow | Homo sapiens (Human) | CVCL_3611 |
CRL2631/CHOP cells | Bone marrow | Homo sapiens (Human) | CVCL_3611 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | The high level of HDAC6 inhibited miR-148b via maintaining the low acetylation of histones H3 and H4 in the miR-148b promoter, thus rescuing Ezrin expression and promoting CHOP resistance in DLBCL. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Diffuse large B-cell lymphoma | [2] | |||
Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
Resistant Drug | Prednisone | |||
Molecule Alteration | Acetylation | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
HDAC6/miR148b/Ezrin signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | CRL2631 cells | Bone marrow | Homo sapiens (Human) | CVCL_3611 |
CRL2631/CHOP cells | Bone marrow | Homo sapiens (Human) | CVCL_3611 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | The high level of HDAC6 inhibited miR-148b via maintaining the low acetylation of histones H3 and H4 in the miR-148b promoter, thus rescuing Ezrin expression and promoting CHOP resistance in DLBCL. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Diffuse large B-cell lymphoma | [2] | |||
Resistant Disease | Diffuse large B-cell lymphoma [ICD-11: 2A81.0] | |||
Resistant Drug | Vincristine | |||
Molecule Alteration | Acetylation | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
HDAC6/miR148b/Ezrin signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | CRL2631 cells | Bone marrow | Homo sapiens (Human) | CVCL_3611 |
CRL2631/CHOP cells | Bone marrow | Homo sapiens (Human) | CVCL_3611 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | The high level of HDAC6 inhibited miR-148b via maintaining the low acetylation of histones H3 and H4 in the miR-148b promoter, thus rescuing Ezrin expression and promoting CHOP resistance in DLBCL. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.