Molecule Information

General Information of the Molecule (ID: Mol01489)
Name
hsa-mir-148b ,Homo sapiens
Synonyms
microRNA 148b
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR148B
Gene ID
442892
Location
chr12:54337216-54337314[+]
Sequence
CAAGCACGAUUAGCAUUUGAGGUGAAGUUCUGUUAUACACUCAGGCUGUGGCUCUCUGAA
AGUCAGUGCAUCACAGAACUUUGUCUCGAAAGCUUUCUA
    Click to Show/Hide
Ensembl ID
ENSG00000199122
HGNC ID
HGNC:31761
Precursor Accession
MI0000811
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [2]
Resistant Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model Panc1 cells Pancreas Homo sapiens (Human) CVCL_0480
In Vivo Model 4 to 6-week-old female non-obese mice with diabetes/severe combined immunodeficiency Mus musculus
Experiment for
Molecule Alteration		 Immunohistochemistry; qRT-PCR
Experiment for
Drug Resistance		 Cell viability assays
Mechanism Description The in vitro drug sensitivity of pancreatic cancer cells was altered according to the miR-1246 expression via CCNG2.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [3]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description The data showed a down-regulated of miR-148b expression and evaluated methyltransferases (DNMTs) expression in cisplatin-resisted human non-small cell lung cancer (NSCLC) cell line-A549/DDP and SPC-A1/DDP compared with their parental A549 and SPC-A1 cell line. In transfection experiments, miR-148b mimics reduced the DNMT1 expression, as well as (+) the sensitivity of cells to cisplatin and cisplatin-induced apoptosis in A549/DDP or SPC-A1/DDP cells. While miR-148b inhibitor increased DNMT1 expression, as well as attenuated the sensitivity of cells to cisplatin in A549 and SPC-A1 cells. miR-148b was showed to exert negative effect on DNMT1 expression by targeting its 3'UTR in A549/DDP and A549 cells. Importantly, silenced DNMT1 increases cisplatin sensitivity of A549/DDP cells and over-expressed DNMT1 reverses pro-apoptosis effect of miR-148b mimic.
Cyclophosphamide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [4]
Resistant Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Resistant Drug Cyclophosphamide
 Drug Info 
Molecule Alteration Acetylation
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
HDAC6/miR148b/Ezrin signaling pathway Regulation N.A.
In Vitro Model CRL2631 cells Bone marrow Homo sapiens (Human) CVCL_3611
CRL2631/CHOP cells Bone marrow Homo sapiens (Human) CVCL_3611
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description The high level of HDAC6 inhibited miR-148b via maintaining the low acetylation of histones H3 and H4 in the miR-148b promoter, thus rescuing Ezrin expression and promoting CHOP resistance in DLBCL.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [4]
Resistant Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Acetylation
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell viability Activation hsa05200
HDAC6/miR148b/Ezrin signaling pathway Regulation N.A.
In Vitro Model CRL2631 cells Bone marrow Homo sapiens (Human) CVCL_3611
CRL2631/CHOP cells Bone marrow Homo sapiens (Human) CVCL_3611
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description The high level of HDAC6 inhibited miR-148b via maintaining the low acetylation of histones H3 and H4 in the miR-148b promoter, thus rescuing Ezrin expression and promoting CHOP resistance in DLBCL.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [5]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
 Disease Info 
Resistant Drug Imatinib
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Caspase-3 activity assay
Mechanism Description Duplicate experiments demonstrated that 15 miRNAs had a >2-fold increase in expression in MYL-R cells relative to MYL cells and that 15 miRNAs showed a >2-fold decrease in relative expression.
Prednisone
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [4]
Resistant Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Resistant Drug Prednisone
 Drug Info 
Molecule Alteration Acetylation
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell viability Activation hsa05200
HDAC6/miR148b/Ezrin signaling pathway Regulation N.A.
In Vitro Model CRL2631 cells Bone marrow Homo sapiens (Human) CVCL_3611
CRL2631/CHOP cells Bone marrow Homo sapiens (Human) CVCL_3611
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description The high level of HDAC6 inhibited miR-148b via maintaining the low acetylation of histones H3 and H4 in the miR-148b promoter, thus rescuing Ezrin expression and promoting CHOP resistance in DLBCL.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [6]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
 Disease Info 
Resistant Drug Sorafenib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
Experiment for
Molecule Alteration		 RT-PCR; Western blot; Luciferase assay
Experiment for
Drug Resistance		 Cytotoxicity assay; Apoptosis assays
Mechanism Description Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [7]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Tamoxifen
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
LCC2 cells Breast Homo sapiens (Human) CVCL_DP51
LCC9 cells Breast Homo sapiens (Human) CVCL_DP52
Experiment for
Molecule Alteration		 Microarray analyses; qPCR; RT-PCR; Western blot
Mechanism Description Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [4]
Resistant Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Acetylation
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell viability Activation hsa05200
HDAC6/miR148b/Ezrin signaling pathway Regulation N.A.
In Vitro Model CRL2631 cells Bone marrow Homo sapiens (Human) CVCL_3611
CRL2631/CHOP cells Bone marrow Homo sapiens (Human) CVCL_3611
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description The high level of HDAC6 inhibited miR-148b via maintaining the low acetylation of histones H3 and H4 in the miR-148b promoter, thus rescuing Ezrin expression and promoting CHOP resistance in DLBCL.
References
Ref 1 Metallo-Beta-lactamase expression confers an advantage to Pseudomonas aeruginosa isolates compared with other Beta-lactam resistance mechanisms, favoring the prevalence of metallo-Beta-lactamase producers in a clinical environment. Microb Drug Resist. 2010 Sep;16(3):223-30. doi: 10.1089/mdr.2010.0016.
Ref 2 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 3 miR-148b reverses cisplatin-resistance in non-small cell cancer cells via negatively regulating DNA (cytosine-5)-methyltransferase 1(DNMT1) expression. J Transl Med. 2015 Apr 28;13:132. doi: 10.1186/s12967-015-0488-y.
Ref 4 Down-regulated miR-148b increases resistance to CHOP in diffuse large B-cell lymphoma cells by rescuing Ezrin. Biomed Pharmacother. 2018 Oct;106:267-274. doi: 10.1016/j.biopha.2018.06.093. Epub 2018 Jun 28.
Ref 5 MiR-34a attenuates paclitaxel-resistance of hormone-refractory prostate cancer PC3 cells through direct and indirect mechanisms. Prostate. 2010 Oct 1;70(14):1501-12. doi: 10.1002/pros.21185.
Ref 6 Downregulation of miR-21 enhances chemotherapeutic effect of taxol in breast carcinoma cells. Technol Cancer Res Treat. 2010 Feb;9(1):77-86. doi: 10.1177/153303461000900109.
Ref 7 PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.