Molecule Information

General Information of the Molecule (ID: Mol01489)
Name
hsa-mir-148b ,Homo sapiens
Synonyms
microRNA 148b
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR148B
Gene ID
442892
Location
chr12:54337216-54337314[+]
Sequence
CAAGCACGAUUAGCAUUUGAGGUGAAGUUCUGUUAUACACUCAGGCUGUGGCUCUCUGAA
AGUCAGUGCAUCACAGAACUUUGUCUCGAAAGCUUUCUA
    Click to Show/Hide
Ensembl ID
ENSG00000199122
HGNC ID
HGNC:31761
Precursor Accession
MI0000811
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [1]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description The data showed a down-regulated of miR-148b expression and evaluated methyltransferases (DNMTs) expression in cisplatin-resisted human non-small cell lung cancer (NSCLC) cell line-A549/DDP and SPC-A1/DDP compared with their parental A549 and SPC-A1 cell line. In transfection experiments, miR-148b mimics reduced the DNMT1 expression, as well as (+) the sensitivity of cells to cisplatin and cisplatin-induced apoptosis in A549/DDP or SPC-A1/DDP cells. While miR-148b inhibitor increased DNMT1 expression, as well as attenuated the sensitivity of cells to cisplatin in A549 and SPC-A1 cells. miR-148b was showed to exert negative effect on DNMT1 expression by targeting its 3'UTR in A549/DDP and A549 cells. Importantly, silenced DNMT1 increases cisplatin sensitivity of A549/DDP cells and over-expressed DNMT1 reverses pro-apoptosis effect of miR-148b mimic.
Cyclophosphamide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [2]
Resistant Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Resistant Drug Cyclophosphamide
 Drug Info 
Molecule Alteration Acetylation
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
HDAC6/miR148b/Ezrin signaling pathway Regulation N.A.
In Vitro Model CRL2631 cells Bone marrow Homo sapiens (Human) CVCL_3611
CRL2631/CHOP cells Bone marrow Homo sapiens (Human) CVCL_3611
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description The high level of HDAC6 inhibited miR-148b via maintaining the low acetylation of histones H3 and H4 in the miR-148b promoter, thus rescuing Ezrin expression and promoting CHOP resistance in DLBCL.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [2]
Resistant Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Acetylation
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell viability Activation hsa05200
HDAC6/miR148b/Ezrin signaling pathway Regulation N.A.
In Vitro Model CRL2631 cells Bone marrow Homo sapiens (Human) CVCL_3611
CRL2631/CHOP cells Bone marrow Homo sapiens (Human) CVCL_3611
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description The high level of HDAC6 inhibited miR-148b via maintaining the low acetylation of histones H3 and H4 in the miR-148b promoter, thus rescuing Ezrin expression and promoting CHOP resistance in DLBCL.
Prednisone
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [2]
Resistant Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Resistant Drug Prednisone
 Drug Info 
Molecule Alteration Acetylation
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell viability Activation hsa05200
HDAC6/miR148b/Ezrin signaling pathway Regulation N.A.
In Vitro Model CRL2631 cells Bone marrow Homo sapiens (Human) CVCL_3611
CRL2631/CHOP cells Bone marrow Homo sapiens (Human) CVCL_3611
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description The high level of HDAC6 inhibited miR-148b via maintaining the low acetylation of histones H3 and H4 in the miR-148b promoter, thus rescuing Ezrin expression and promoting CHOP resistance in DLBCL.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [2]
Resistant Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Acetylation
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell viability Activation hsa05200
HDAC6/miR148b/Ezrin signaling pathway Regulation N.A.
In Vitro Model CRL2631 cells Bone marrow Homo sapiens (Human) CVCL_3611
CRL2631/CHOP cells Bone marrow Homo sapiens (Human) CVCL_3611
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description The high level of HDAC6 inhibited miR-148b via maintaining the low acetylation of histones H3 and H4 in the miR-148b promoter, thus rescuing Ezrin expression and promoting CHOP resistance in DLBCL.
References
Ref 1 miR-148b reverses cisplatin-resistance in non-small cell cancer cells via negatively regulating DNA (cytosine-5)-methyltransferase 1(DNMT1) expression. J Transl Med. 2015 Apr 28;13:132. doi: 10.1186/s12967-015-0488-y.
Ref 2 Down-regulated miR-148b increases resistance to CHOP in diffuse large B-cell lymphoma cells by rescuing Ezrin. Biomed Pharmacother. 2018 Oct;106:267-274. doi: 10.1016/j.biopha.2018.06.093. Epub 2018 Jun 28.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.