Molecule Information

General Information of the Molecule (ID: Mol01481)

• Name: hsa-mir-383 ,Homo sapiens
• Synonyms: microRNA 383
• Molecule Type: Precursor miRNA
• Gene Name: MIR383
• Gene ID: 494332
• Location: chr8:14853438-14853510[-]
• Sequence:
  CUCCUCAGAUCAGAAGGUGAUUGUGGCUUUGGGUGGAUAUUAAUCAGCCACAGCACUGCC
  UGGUCAGAAAGAG
• Ensembl ID: ENSG00000199127
• HGNC ID: HGNC:31876
• Precursor Accession: MI0000791

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Testicular cancer [.] [1]

• Resistant Disease: Testicular cancer [.]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-qPCR with "Low Density Array"
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Examining almost all known human micro-RNA species confirmed the miR-371-373 cluster as a promising target for explaining cisplatin resistance, potentially by counteracting wild-type P53 induced senescence or linking it with the potency to differentiate. Moreover, we describe for the first time an association of the up-regulation of micro-RNA species such as hsa-miR-512-3p/-515/-517/-518/-525 and down-regulation of hsa-miR-99a/-100/-145 with a cisplatin resistant phenotype in human germ cell tumors.

Daunorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] [2]

• Resistant Disease: Acute lymphocytic leukemia [ICD-11: 2B33.0]
• Resistant Drug: Daunorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: RT-qPCR; RT-PCR
• Experiment for Drug Resistance: Flow cytometry; MTT assay
• Mechanism Description: Resistance to vincristine and daunorubicin was characterized by an approximately 20-fold up-regulation of miR-125b, miR-99a and miR-100 (P(FDR)<=0.002). No discriminative microRNA were found for prednisolone response and only one microRNA was linked to resistance to L-asparaginase. A combined expression profile based on 14 microRNA that were individually associated with prognosis, was highly predictive of clinical outcome in pediatric acute lymphoblastic leukemia (5-year disease-free survival of 89.4%+-7% versus 60.8+-12%, P=0.001).

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [4]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: SNU449 cells; Liver; Homo sapiens (Human); CVCL_0454
• In Vitro Model: SNU387 cells; Liver; Homo sapiens (Human); CVCL_0250
• In Vivo Model: BALB/c nude mice model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-383 inhibited Dox resistance in HCC cells by downregulating EIF5A2.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [5]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experiment for Molecule Alteration: Real-time PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: CircLRCH3 and FGF7 levels were up-regulated, while miR-383-5p level was reduced in OXA-resistant GC tissues and cells. Depletion of circLRCH3 attenuated the resistance of OXA-resistant cells to OXA. CircLRCH3 silence reduced OXA resistance by regulating miR-383-5p. Besides, miR-383-5p elevated OXA sensitivity of GC cells by repressing FGF7. Moreover, the deletion of circLRCH3 increased OXA sensitivity in vivo.

References

• Ref 1: Down-regulation of miR-27a might inhibit proliferation and drug resistance of gastric cancer cells. J Exp Clin Cancer Res. 2011 May 13;30(1):55. doi: 10.1186/1756-9966-30-55.
• Ref 2: BCR-ABL1 mutations in patients with imatinib-resistant Philadelphia chromosome-positive leukemia by use of the PCR-Invader assay. Leuk Res. 2011 May;35(5):598-603. doi: 10.1016/j.leukres.2010.12.006. Epub 2011 Jan 15.
• Ref 3: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 4: MicroRNA-383 inhibits doxorubicin resistance in hepatocellular carcinoma by targeting eukaryotic translation initiation factor 5A2. J Cell Mol Med. 2019 Nov;23(11):7190-7199. doi: 10.1111/jcmm.14197. Epub 2019 Feb 23.
• Ref 5: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.