Molecule Information
General Information of the Molecule (ID: Mol01481)
Name |
hsa-mir-383
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 383
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR383
|
||||
Gene ID | |||||
Location |
chr8:14853438-14853510[-]
|
||||
Sequence |
CUCCUCAGAUCAGAAGGUGAUUGUGGCUUUGGGUGGAUAUUAAUCAGCCACAGCACUGCC
UGGUCAGAAAGAG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular carcinoma | [1] | |||
Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell viability | Inhibition | hsa05200 | ||
In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
SNU449 cells | Liver | Homo sapiens (Human) | CVCL_0454 | |
SNU387 cells | Liver | Homo sapiens (Human) | CVCL_0250 | |
In Vivo Model | BALB/c nude mice model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR-383 inhibited Dox resistance in HCC cells by downregulating EIF5A2. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.