Molecule Information
General Information of the Molecule (ID: Mol01478)
| Name |
hsa-mir-379
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 379
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR379
|
||||
| Gene ID | |||||
| Location |
chr14:101022066-101022132[+]
|
||||
| Sequence |
AGAGAUGGUAGACUAUGGAACGUAGGCGUUAUGAUUUCUGACCUAUGUAACAUGGUCCAC
UAACUCU Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [1] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 | |
| SPC-A1 cells | Lung | Homo sapiens (Human) | CVCL_6955 | |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| Sk-MES-1 cells | Lung | Homo sapiens (Human) | CVCL_0630 | |
| 16HBE cells | Lung | Homo sapiens (Human) | CVCL_0112 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Colony formation assay | |||
| Mechanism Description | Suppression of EIF4G2 by miR379 potentiates the cisplatin chemosensitivity in nonsmall cell lung cancer cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [2] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | IGF1/IGF1R signaling pathway | Inhibition | hsa05200 | |
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Propidium Iodide (PI) Staining | |||
| Mechanism Description | IGF1 is a hub gene in HCC and is involved in the p53 signaling pathway regulation. miR379 can sensitize HCC cells to chemotherapeutic reagents via targeting IGF1R and suppressing its expression, and suppressing the IGF1/IGF1R signaling pathway. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [2] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | IGF1/IGF1R signaling pathway | Inhibition | hsa05200 | |
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Propidium Iodide (PI) Staining | |||
| Mechanism Description | IGF1 is a hub gene in HCC and is involved in the p53 signaling pathway regulation. miR379 can sensitize HCC cells to chemotherapeutic reagents via targeting IGF1R and suppressing its expression, and suppressing the IGF1/IGF1R signaling pathway. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [2] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | IGF1/IGF1R signaling pathway | Inhibition | hsa05200 | |
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Propidium Iodide (PI) Staining | |||
| Mechanism Description | IGF1 is a hub gene in HCC and is involved in the p53 signaling pathway regulation. miR379 can sensitize HCC cells to chemotherapeutic reagents via targeting IGF1R and suppressing its expression, and suppressing the IGF1/IGF1R signaling pathway. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] | [3] | |||
| Sensitive Disease | Malignant pleural mesothelioma [ICD-11: 2C26.0] | |||
| Sensitive Drug | Pemetrexed | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MSTO-211H cells | Lung | Homo sapiens (Human) | CVCL_1430 |
| ACC-MESO1 cells | Lung | Homo sapiens (Human) | CVCL_5113 | |
| ACC-MESO4 cells | Lung | Homo sapiens (Human) | CVCL_5114 | |
| NCI-H2052 cells | Lung | Homo sapiens (Human) | CVCL_1518 | |
| NCI-H2452 cells | Lung | Homo sapiens (Human) | CVCL_1553 | |
| NCI-H28 cells | Lung | Homo sapiens (Human) | CVCL_1555 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | miR-379 and miR-411 play a key role in the carcinogenesis of MPM cells by targeting IL-18 and contributing to the sensitivity of MPM cells to SAHA and PEM. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] | [3] | |||
| Sensitive Disease | Malignant pleural mesothelioma [ICD-11: 2C26.0] | |||
| Sensitive Drug | Vorinostat | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MSTO-211H cells | Lung | Homo sapiens (Human) | CVCL_1430 |
| ACC-MESO1 cells | Lung | Homo sapiens (Human) | CVCL_5113 | |
| ACC-MESO4 cells | Lung | Homo sapiens (Human) | CVCL_5114 | |
| NCI-H2052 cells | Lung | Homo sapiens (Human) | CVCL_1518 | |
| NCI-H2452 cells | Lung | Homo sapiens (Human) | CVCL_1553 | |
| NCI-H28 cells | Lung | Homo sapiens (Human) | CVCL_1555 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | miR-379 and miR-411 play a key role in the carcinogenesis of MPM cells by targeting IL-18 and contributing to the sensitivity of MPM cells to SAHA and PEM. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
