Molecule Information
General Information of the Molecule (ID: Mol01474)
| Name |
hsa-mir-375
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 375
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR375
|
||||
| Gene ID | |||||
| Location |
chr2:219001645-219001708[-]
|
||||
| Sequence |
CCCCGCGACGAGCCCCUCGCACAAACCGGACCUGAGCGUUUUGUUCGUUCGGCUCGCGUG
AGGC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
10 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [1] | |||
| Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Resistant Drug | Cetuximab | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | AKT signaling pathway | Inhibition | hsa04151 | |
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | GEO CR cells | Colon | Homo sapiens (Human) | CVCL_0271 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | The ability of miR-199a-5p and miR-375 to target PHLPP1 (PH domain and leucine-rich repeat protein phosphatase 1), a tumor suppressor that negatively regulates the AkT pathway, accounts, at least in part, for their drug-resistance activity. Indeed, restoration of PHLPP1 increases sensitivity of the GEO cells to CTX and reverts the resistance-promoting effect of miR-199a-5p and miR-375. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung cancer [ICD-11: 2C25.0] | [2] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | NCI-H1650 cells | Lung | Homo sapiens (Human) | CVCL_1483 |
| NCI-H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 | |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| NCI-H1299 cells | Lymph node | Homo sapiens (Human) | CVCL_0060 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | In this study, miR-375 showed the ability to promote cisplatin sensitivity and apoptosis of LUAD. Genes correlated with miR-375 in LUAD were analyzed and ABCC8 showed the strongest positive correlation. Moreover, transcription factors that regulate miR-375 expression were predicted. MBNL1, PTPN3, PRKD1 and RPN1 were identified as the target genes of miR-375. Enrichment analysis demonstrated that miR-375-related genes associated with promoting cell proliferation and anti-apoptosis were involved in the MAPK signaling pathway. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Prostate cancer [ICD-11: 2C82.0] | [3] | |||
| Resistant Disease | Prostate cancer [ICD-11: 2C82.0] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | DU-145 cells | Prostate | Homo sapiens (Human) | CVCL_0105 |
| PC3 cells | Prostate | Homo sapiens (Human) | CVCL_0035 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Annexin V-PE Apoptosis assay | |||
| Mechanism Description | miR375 induces docetaxel resistance in prostate cancer by targeting SEC23A and YAP1. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [4] | |||
| Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vivo Model | A retrospective survey in conducting clinical studies | Homo sapiens | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Multivariate analysis of overall survival or disease-free survival assay | |||
| Mechanism Description | miR375 overexpression could increase the cisplatin sensitivity of human gastric cancer cells by regulating ERBB2. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [5] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | MCF-7/PTX cells | Breast | Homo sapiens (Human) | CVCL_4V97 |
| Experiment for Molecule Alteration |
qRT-PCR; MSP assay | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-375 is downregulated in MCF-7/ADM and MCF-7/PTX cells, and its downregulation is a result of promoter methylation. miR-375 can directly target 3'UTR of YBX1 and, thereby, decrease its expression, which might be an important mechanism of MDR in breast cancer cells. miR-375 is downregulated in MCF-7/ADM and MCF-7/PTX cells, and its downregulation is a result of promoter methylation. miR-375 can directly target 3'UTR of YBX1 and thereby decrease its expression, which might be an important mechanism of MDR in breast cancer cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [6] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Epirubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vivo Model | Breast cancer patients | Homo sapiens | ||
| Experiment for Molecule Alteration |
TaqMan Real-time PCR microRNA Array | |||
| Mechanism Description | After being analyzed, 8 miRNAs satisfied the criteria. Of those 8 miRNAs, 6 were up-regulated and 2 were down-regulated in the resistant group compared with the sensitive group. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [4] | |||
| Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Resistant Drug | Methotrexate | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vivo Model | A retrospective survey in conducting clinical studies | Homo sapiens | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Multivariate analysis of overall survival or disease-free survival assay | |||
| Mechanism Description | miR375 overexpression could increase the cisplatin sensitivity of human gastric cancer cells by regulating ERBB2. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [7] | |||
| Resistant Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | Siha cells | Cervix uteri | Homo sapiens (Human) | CVCL_0032 |
| Caski cells | Uterus | Homo sapiens (Human) | CVCL_1100 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | Paclitaxel transiently induced up-regulation of miR-375 expression, proliferation inhibition, transition from epithelial to mesenchymal phenotype, and consequently impaired paclitaxel sensitivity. Forced over-expression of miR-375 may suppress Ecadherin expression by a directly targeting pathway, which led to paclitaxel resistance. Contrarily, re-expression of Ecadherin partly reversed epithelial-mesenchymal transition phenotype and miR-375 induced paclitaxel-resistance. Our findings suggest that paclitaxel-induced miR-375 over-expression facilitates epithelial-mesenchymal transition process via directly targeting Ecadherin, proliferation inhibition, and consequently results in chemo-resistance in cervical cancer cells. | |||
| Disease Class: Cervical cancer [ICD-11: 2C77.0] | [8] | |||
| Resistant Disease | Cervical cancer [ICD-11: 2C77.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | Siha cells | Cervix uteri | Homo sapiens (Human) | CVCL_0032 |
| Caski cells | Uterus | Homo sapiens (Human) | CVCL_1100 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | Paclitaxel induced upregulated miR-375 expression in a clear dose-dependent manner. Forced overexpression of miR-375 in cervical cancer cells decreased paclitaxel sensitivity in vitro and in vivo. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [5] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | MCF-7/PTX cells | Breast | Homo sapiens (Human) | CVCL_4V97 |
| Experiment for Molecule Alteration |
qRT-PCR; MSP assay | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-375 is downregulated in MCF-7/ADM and MCF-7/PTX cells, and its downregulation is a result of promoter methylation. miR-375 can directly target 3'UTR of YBX1 and, thereby, decrease its expression, which might be an important mechanism of MDR in breast cancer cells. miR-375 is downregulated in MCF-7/ADM and MCF-7/PTX cells, and its downregulation is a result of promoter methylation. miR-375 can directly target 3'UTR of YBX1 and thereby decrease its expression, which might be an important mechanism of MDR in breast cancer cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatic carcinoma [ICD-11: 2C12.3] | [9] | |||
| Resistant Disease | Hepatic carcinoma [ICD-11: 2C12.3] | |||
| Resistant Drug | Sorafenib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| Huh7 cells | Kidney | Homo sapiens (Human) | CVCL_U442 | |
| Huh1 cells | Liver | Homo sapiens (Human) | CVCL_2956 | |
| In Vivo Model | BALB/c athymic nude mice | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR; Western blot analysis; ELISA assay | |||
| Mechanism Description | The expression of the tumor-suppressive miRNA miR-375 was significantly induced in hepatoma cells treated with sorafenib, and miR-375 could exert its antiangiogenic effect partially via platelet-derived growth factor C (PDGFC) inhibition. Sorafenib inhibited PDGFC expression by inducing the expression of miR-375 and a transcription factor, achaete-scute homolog-1 (ASH1), mediated the induction of miR-375 by sorafeinb administration in hepatoma cells. The expression of miR-375 was reduced in sorafenib-resistant cells and that the restoration of miR-375 could resensitize sorafenib-resistant cells to sorafenib partially by the degradation of astrocyte elevated gene-1 (AEG-1). | |||
| Disease Class: Hepatic carcinoma [ICD-11: 2C12.3] | [9] | |||
| Resistant Disease | Hepatic carcinoma [ICD-11: 2C12.3] | |||
| Resistant Drug | Sorafenib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| Huh7 cells | Kidney | Homo sapiens (Human) | CVCL_U442 | |
| Huh1 cells | Liver | Homo sapiens (Human) | CVCL_2956 | |
| In Vivo Model | BALB/c athymic nude mice | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR; Western blot analysis; ELISA assay | |||
| Mechanism Description | The expression of the tumor-suppressive miRNA miR-375 was significantly induced in hepatoma cells treated with sorafenib, and miR-375 could exert its antiangiogenic effect partially via platelet-derived growth factor C (PDGFC) inhibition. Sorafenib inhibited PDGFC expression by inducing the expression of miR-375 and a transcription factor, achaete-scute homolog-1 (ASH1), mediated the induction of miR-375 by sorafeinb administration in hepatoma cells. The expression of miR-375 was reduced in sorafenib-resistant cells and that the restoration of miR-375 could resensitize sorafenib-resistant cells to sorafenib partially by the degradation of astrocyte elevated gene-1 (AEG-1). | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [10] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Tamoxifen | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell migration | Activation | hsa04670 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Cell titer glo assay | |||
| Mechanism Description | Overexpression of MTDH increased mesenchymal markers while downregulating E-cadherin expression, associated with poor prognosis and increased risk of metastasis in breast cancer. Tamoxifen-sensitive cells expressing miRNA-375 at high levels directly represses MTDH expression, and that this regulation confers the cells with a tamoxifen sensitive and epithelial phenotype. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [10] | |||
| Resistant Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Resistant Drug | Tamoxifen | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell migration | Activation | hsa04670 | |
| In Vitro Model | H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 |
| H1703 cells | Lung | Homo sapiens (Human) | CVCL_1490 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Cell titer glo assay | |||
| Mechanism Description | Overexpression of MTDH increased mesenchymal markers while downregulating E-cadherin expression, associated with poor prognosis and increased risk of metastasis in breast cancer. Tamoxifen-sensitive cells expressing miRNA-375 at high levels directly represses MTDH expression, and that this regulation confers the cells with a tamoxifen sensitive and epithelial phenotype. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [10] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Tamoxifen | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell migration | Activation | hsa04670 | |
| In Vitro Model | OVCAR5 cells | Ovary | Homo sapiens (Human) | CVCL_1628 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Cell titer glo assay | |||
| Mechanism Description | Overexpression of MTDH increased mesenchymal markers while downregulating E-cadherin expression, associated with poor prognosis and increased risk of metastasis in breast cancer. Tamoxifen-sensitive cells expressing miRNA-375 at high levels directly represses MTDH expression, and that this regulation confers the cells with a tamoxifen sensitive and epithelial phenotype. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [11] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Tamoxifen | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR375 inhibits cancer stem cell phenotype and tamoxifen resistance by degrading HOXB3 in human ER-positive breast cancer Overexpression of HOXB3 induced formation of CSC phenotypes, EMT and tamoxifen-resistance as well as enhanced ability of migration and invasion in MCF-7 cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: HER2 positive breast cancer [ICD-11: 2C60.8] | [12] | |||
| Resistant Disease | HER2 positive breast cancer [ICD-11: 2C60.8] | |||
| Resistant Drug | Trastuzumab | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| PI3K/AKT signaling pathway | Activation | hsa04151 | ||
| In Vitro Model | SkBR3 cells | Breast | Homo sapiens (Human) | CVCL_0033 |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Insulin-like growth factor-1 receptor (IGF1R) is thought to play a key role in the acquisition of cancer resistance to trastuzumab and other targeted pharmaceuticals. Epigenetic silencing of miR-375 causes the upregulation of IGF1R, which at least partially underlies trastuzumab resistance of breast cancer cells. | |||
Investigative Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [13] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | RAWQ01 | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| OVCAR3 cells | Ovary | Homo sapiens (Human) | CVCL_0465 | |
| HO8910 cells | Ovary | Homo sapiens (Human) | CVCL_6868 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Over-expression of miR-375 sensitized the ovarian cancer cells to RAWQ01. miR-375 enhanced the in vitro sensitivity of ovarian cancer cells to RAWQ01 by inducing apoptosis. miR-375 also increased the in vivo chemosensitivity of ovarian cancer cells to RAWQ01. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
