General Information of the Molecule (ID: Mol01474)
Name
hsa-mir-375 ,Homo sapiens
Synonyms
microRNA 375
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR375
Gene ID
494324
Location
chr2:219001645-219001708[-]
Sequence
CCCCGCGACGAGCCCCUCGCACAAACCGGACCUGAGCGUUUUGUUCGUUCGGCUCGCGUG
AGGC
    Click to Show/Hide
Ensembl ID
ENSG00000198973
HGNC ID
HGNC:31868
Precursor Accession
MI0000783
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
10 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cetuximab
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [1]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
Resistant Drug Cetuximab
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT signaling pathway Inhibition hsa04151
Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model GEO CR cells Colon Homo sapiens (Human) CVCL_0271
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description The ability of miR-199a-5p and miR-375 to target PHLPP1 (PH domain and leucine-rich repeat protein phosphatase 1), a tumor suppressor that negatively regulates the AkT pathway, accounts, at least in part, for their drug-resistance activity. Indeed, restoration of PHLPP1 increases sensitivity of the GEO cells to CTX and reverts the resistance-promoting effect of miR-199a-5p and miR-375.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.0] [2]
Sensitive Disease Lung cancer [ICD-11: 2C25.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model NCI-H1650 cells Lung Homo sapiens (Human) CVCL_1483
NCI-H1975 cells Lung Homo sapiens (Human) CVCL_1511
A549 cells Lung Homo sapiens (Human) CVCL_0023
NCI-H1299 cells Lymph node Homo sapiens (Human) CVCL_0060
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description In this study, miR-375 showed the ability to promote cisplatin sensitivity and apoptosis of LUAD. Genes correlated with miR-375 in LUAD were analyzed and ABCC8 showed the strongest positive correlation. Moreover, transcription factors that regulate miR-375 expression were predicted. MBNL1, PTPN3, PRKD1 and RPN1 were identified as the target genes of miR-375. Enrichment analysis demonstrated that miR-375-related genes associated with promoting cell proliferation and anti-apoptosis were involved in the MAPK signaling pathway.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [3]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
Resistant Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
PC3 cells Prostate Homo sapiens (Human) CVCL_0035
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Annexin V-PE Apoptosis assay
Mechanism Description miR375 induces docetaxel resistance in prostate cancer by targeting SEC23A and YAP1.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [4]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vivo Model A retrospective survey in conducting clinical studies Homo sapiens
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Multivariate analysis of overall survival or disease-free survival assay
Mechanism Description miR375 overexpression could increase the cisplatin sensitivity of human gastric cancer cells by regulating ERBB2.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [5]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7/PTX cells Breast Homo sapiens (Human) CVCL_4V97
Experiment for
Molecule Alteration
qRT-PCR; MSP assay
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-375 is downregulated in MCF-7/ADM and MCF-7/PTX cells, and its downregulation is a result of promoter methylation. miR-375 can directly target 3'UTR of YBX1 and, thereby, decrease its expression, which might be an important mechanism of MDR in breast cancer cells. miR-375 is downregulated in MCF-7/ADM and MCF-7/PTX cells, and its downregulation is a result of promoter methylation. miR-375 can directly target 3'UTR of YBX1 and thereby decrease its expression, which might be an important mechanism of MDR in breast cancer cells.
Epirubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [6]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Epirubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vivo Model Breast cancer patients Homo sapiens
Experiment for
Molecule Alteration
TaqMan Real-time PCR microRNA Array
Mechanism Description After being analyzed, 8 miRNAs satisfied the criteria. Of those 8 miRNAs, 6 were up-regulated and 2 were down-regulated in the resistant group compared with the sensitive group.
Methotrexate
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [4]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
Resistant Drug Methotrexate
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vivo Model A retrospective survey in conducting clinical studies Homo sapiens
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
Multivariate analysis of overall survival or disease-free survival assay
Mechanism Description miR375 overexpression could increase the cisplatin sensitivity of human gastric cancer cells by regulating ERBB2.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Cervical cancer [ICD-11: 2C77.0] [7]
Resistant Disease Cervical cancer [ICD-11: 2C77.0]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model Siha cells Cervix uteri Homo sapiens (Human) CVCL_0032
Caski cells Uterus Homo sapiens (Human) CVCL_1100
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description Paclitaxel transiently induced up-regulation of miR-375 expression, proliferation inhibition, transition from epithelial to mesenchymal phenotype, and consequently impaired paclitaxel sensitivity. Forced over-expression of miR-375 may suppress Ecadherin expression by a directly targeting pathway, which led to paclitaxel resistance. Contrarily, re-expression of Ecadherin partly reversed epithelial-mesenchymal transition phenotype and miR-375 induced paclitaxel-resistance. Our findings suggest that paclitaxel-induced miR-375 over-expression facilitates epithelial-mesenchymal transition process via directly targeting Ecadherin, proliferation inhibition, and consequently results in chemo-resistance in cervical cancer cells.
Disease Class: Cervical cancer [ICD-11: 2C77.0] [8]
Resistant Disease Cervical cancer [ICD-11: 2C77.0]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
Cell viability Activation hsa05200
In Vitro Model Siha cells Cervix uteri Homo sapiens (Human) CVCL_0032
Caski cells Uterus Homo sapiens (Human) CVCL_1100
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description Paclitaxel induced upregulated miR-375 expression in a clear dose-dependent manner. Forced overexpression of miR-375 in cervical cancer cells decreased paclitaxel sensitivity in vitro and in vivo.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [5]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7/PTX cells Breast Homo sapiens (Human) CVCL_4V97
Experiment for
Molecule Alteration
qRT-PCR; MSP assay
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-375 is downregulated in MCF-7/ADM and MCF-7/PTX cells, and its downregulation is a result of promoter methylation. miR-375 can directly target 3'UTR of YBX1 and, thereby, decrease its expression, which might be an important mechanism of MDR in breast cancer cells. miR-375 is downregulated in MCF-7/ADM and MCF-7/PTX cells, and its downregulation is a result of promoter methylation. miR-375 can directly target 3'UTR of YBX1 and thereby decrease its expression, which might be an important mechanism of MDR in breast cancer cells.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatic carcinoma [ICD-11: 2C12.3] [9]
Resistant Disease Hepatic carcinoma [ICD-11: 2C12.3]
Resistant Drug Sorafenib
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
Huh7 cells Kidney Homo sapiens (Human) CVCL_U442
Huh1 cells Liver Homo sapiens (Human) CVCL_2956
In Vivo Model BALB/c athymic nude mice Mus musculus
Experiment for
Molecule Alteration
qRT-PCR; Western blot analysis; ELISA assay
Mechanism Description The expression of the tumor-suppressive miRNA miR-375 was significantly induced in hepatoma cells treated with sorafenib, and miR-375 could exert its antiangiogenic effect partially via platelet-derived growth factor C (PDGFC) inhibition. Sorafenib inhibited PDGFC expression by inducing the expression of miR-375 and a transcription factor, achaete-scute homolog-1 (ASH1), mediated the induction of miR-375 by sorafeinb administration in hepatoma cells. The expression of miR-375 was reduced in sorafenib-resistant cells and that the restoration of miR-375 could resensitize sorafenib-resistant cells to sorafenib partially by the degradation of astrocyte elevated gene-1 (AEG-1).
Disease Class: Hepatic carcinoma [ICD-11: 2C12.3] [9]
Resistant Disease Hepatic carcinoma [ICD-11: 2C12.3]
Resistant Drug Sorafenib
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
Huh7 cells Kidney Homo sapiens (Human) CVCL_U442
Huh1 cells Liver Homo sapiens (Human) CVCL_2956
In Vivo Model BALB/c athymic nude mice Mus musculus
Experiment for
Molecule Alteration
qRT-PCR; Western blot analysis; ELISA assay
Mechanism Description The expression of the tumor-suppressive miRNA miR-375 was significantly induced in hepatoma cells treated with sorafenib, and miR-375 could exert its antiangiogenic effect partially via platelet-derived growth factor C (PDGFC) inhibition. Sorafenib inhibited PDGFC expression by inducing the expression of miR-375 and a transcription factor, achaete-scute homolog-1 (ASH1), mediated the induction of miR-375 by sorafeinb administration in hepatoma cells. The expression of miR-375 was reduced in sorafenib-resistant cells and that the restoration of miR-375 could resensitize sorafenib-resistant cells to sorafenib partially by the degradation of astrocyte elevated gene-1 (AEG-1).
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [10]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Activation hsa04670
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Cell titer glo assay
Mechanism Description Overexpression of MTDH increased mesenchymal markers while downregulating E-cadherin expression, associated with poor prognosis and increased risk of metastasis in breast cancer. Tamoxifen-sensitive cells expressing miRNA-375 at high levels directly represses MTDH expression, and that this regulation confers the cells with a tamoxifen sensitive and epithelial phenotype.
Disease Class: Lung cancer [ICD-11: 2C25.5] [10]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Activation hsa04670
In Vitro Model H1299 cells Lung Homo sapiens (Human) CVCL_0060
H1703 cells Lung Homo sapiens (Human) CVCL_1490
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Cell titer glo assay
Mechanism Description Overexpression of MTDH increased mesenchymal markers while downregulating E-cadherin expression, associated with poor prognosis and increased risk of metastasis in breast cancer. Tamoxifen-sensitive cells expressing miRNA-375 at high levels directly represses MTDH expression, and that this regulation confers the cells with a tamoxifen sensitive and epithelial phenotype.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [10]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Activation hsa04670
In Vitro Model OVCAR5 cells Ovary Homo sapiens (Human) CVCL_1628
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Cell titer glo assay
Mechanism Description Overexpression of MTDH increased mesenchymal markers while downregulating E-cadherin expression, associated with poor prognosis and increased risk of metastasis in breast cancer. Tamoxifen-sensitive cells expressing miRNA-375 at high levels directly represses MTDH expression, and that this regulation confers the cells with a tamoxifen sensitive and epithelial phenotype.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [11]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Tamoxifen
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR375 inhibits cancer stem cell phenotype and tamoxifen resistance by degrading HOXB3 in human ER-positive breast cancer Overexpression of HOXB3 induced formation of CSC phenotypes, EMT and tamoxifen-resistance as well as enhanced ability of migration and invasion in MCF-7 cells.
Trastuzumab
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: HER2 positive breast cancer [ICD-11: 2C60.8] [12]
Resistant Disease HER2 positive breast cancer [ICD-11: 2C60.8]
Resistant Drug Trastuzumab
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
PI3K/AKT signaling pathway Activation hsa04151
In Vitro Model SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Insulin-like growth factor-1 receptor (IGF1R) is thought to play a key role in the acquisition of cancer resistance to trastuzumab and other targeted pharmaceuticals. Epigenetic silencing of miR-375 causes the upregulation of IGF1R, which at least partially underlies trastuzumab resistance of breast cancer cells.
Investigative Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
RAWQ01
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [13]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
Sensitive Drug RAWQ01
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
OVCAR3 cells Ovary Homo sapiens (Human) CVCL_0465
HO8910 cells Ovary Homo sapiens (Human) CVCL_6868
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Over-expression of miR-375 sensitized the ovarian cancer cells to RAWQ01. miR-375 enhanced the in vitro sensitivity of ovarian cancer cells to RAWQ01 by inducing apoptosis. miR-375 also increased the in vivo chemosensitivity of ovarian cancer cells to RAWQ01.
References
Ref 1 MiR-199a-5p and miR-375 affect colon cancer cell sensitivity to cetuximab by targeting PHLPP1. Expert Opin Ther Targets. 2015;19(8):1017-26. doi: 10.1517/14728222.2015.1057569. Epub 2015 Jun 24.
Ref 2 Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
Ref 3 miR-375 induces docetaxel resistance in prostate cancer by targeting SEC23A and YAP1. Mol Cancer. 2016 Nov 10;15(1):70. doi: 10.1186/s12943-016-0556-9.
Ref 4 MicroRNA-375 as a potential serum biomarker for the diagnosis, prognosis, and chemosensitivity prediction of osteosarcoma. J Int Med Res. 2018 Mar;46(3):975-983. doi: 10.1177/0300060517734114. Epub 2017 Nov 8.
Ref 5 MiR-375 is epigenetically downregulated due to promoter methylation and modulates multi-drug resistance in breast cancer cells via targeting YBX1. Eur Rev Med Pharmacol Sci. 2016 Jul;20(15):3223-9.
Ref 6 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 7 miR-375 mediated acquired chemo-resistance in cervical cancer by facilitating EMT. PLoS One. 2014 Oct 16;9(10):e109299. doi: 10.1371/journal.pone.0109299. eCollection 2014.
Ref 8 miR-375 is upregulated in acquired paclitaxel resistance in cervical cancer. Br J Cancer. 2013 Jul 9;109(1):92-9. doi: 10.1038/bjc.2013.308. Epub 2013 Jun 18.
Ref 9 MicroRNA-375 represses tumor angiogenesis and reverses resistance to sorafenib in hepatocarcinoma .Cancer Gene Ther. 2021 Feb;28(1-2):126-140. doi: 10.1038/s41417-020-0191-x. Epub 2020 Jul 3. 10.1038/s41417-020-0191-x
Ref 10 Re-expression of microRNA-375 reverses both tamoxifen resistance and accompanying EMT-like properties in breast cancer. Oncogene. 2013 Feb 28;32(9):1173-82. doi: 10.1038/onc.2012.128. Epub 2012 Apr 16.
Ref 11 miR-375 inhibits cancer stem cell phenotype and tamoxifen resistance by degrading HOXB3 in human ER-positive breast cancer. Oncol Rep. 2017 Feb;37(2):1093-1099. doi: 10.3892/or.2017.5360. Epub 2017 Jan 9.
Ref 12 Epigenetic silencing of miR-375 induces trastuzumab resistance in HER2-positive breast cancer by targeting IGF1R. BMC Cancer. 2014 Feb 26;14:134. doi: 10.1186/1471-2407-14-134.
Ref 13 Mir-375 enhances ruthenium-derived compound Rawq01 induced cell death in human ovarian cancer. Int J Clin Exp Pathol. 2013 May 15;6(6):1095-102. Print 2013.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.