General Information of the Molecule (ID: Mol01466)
Name
hsa-mir-363 ,Homo sapiens
Synonyms
microRNA 363
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR363
Gene ID
574031
Location
chrX:134169378-134169452[-]
Sequence
UGUUGUCGGGUGGAUCACGAUGCAAUUUUGAUGAGUAUCAUAGGAGAAAAAUUGCACGGU
AUCCAUCUGUAAACC
    Click to Show/Hide
Ensembl ID
ENSG00000284499
HGNC ID
HGNC:32023
Precursor Accession
MI0000764
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
HGC27 cells Gastric Homo sapiens (Human) CVCL_1279
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-363 promotes gastric cancer cells proliferation by inhibiting FBW7 expression and was associated with chemo-resistance of gastric cancer cells. Silencing FBW7 largely phenocopied miR-363-induced resistance to chemotherapy agents and promoted proliferation in gastric cancer cells. In addition, an inverse correlation between miR-363 and FBW7 mRNA expression was observed in gastric cancer tissues.
Disease Class: Hepatocellular carcinoma [2]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
miR363/Mcl-1 signaling pathway Regulation hsa05206
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Cisplatin-based chemotherapy decreased miR-363 expression in HCC patients. miR-363 expression was also lower in HepG2-R cells than in HepG2 cells, which indicated that the downregulation of miR-363 may be related to cisplatin resistance. overexpression of miR-363 by its mimics can effectively increase the sensitivity of cisplatin-resistant HepG2 cells to cisplatin-induced apoptosis. overexpression of miR-363 could inhibit the expression of Mcl-1 in HepG2-R cells, which implied the inverse correlation between the expression of miR-363 and Mcl-1. More importantly, enforced exogenous Mcl-1 significantly attenuated apoptosis induced by cisplatin. All these results support that Mcl-1 is the target of miR-363 which can enhance sensitivity of human cisplatin-resistant HCC cell cisplatin at least partially.
Disease Class: Epithelial ovarian cancer [3]
Resistant Disease Epithelial ovarian cancer [ICD-11: 2B5D.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Mechanism Description Down-regulation of miR-363 led to cisplatin resistance in the epithelial ovarian cancer.
Disease Class: Epithelial ovarian cancer [3]
Resistant Disease Epithelial ovarian cancer [ICD-11: 2B5D.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Mechanism Description Down-regulation of miR-363 led to cisplatin resistance in the epithelial ovarian cancer.
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Ovarian cancer [4]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Activation hsa05200
In Vitro Model A2780CP cells Ovary Homo sapiens (Human) CVCL_0135
A2780s cells Ovary Homo sapiens (Human) CVCL_4863
C13 cells Ovary Homo sapiens (Human) CVCL_0114
OV2008 cells Ovary Homo sapiens (Human) CVCL_0473
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Snail overexpression could significantly attenuate miR-363-suppressed cisplatin resistance of EOC cells, suggesting that miR-363-regulated cisplatin resistance is mediated by snail-induced EMT in EOC cells.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
HGC27 cells Gastric Homo sapiens (Human) CVCL_1279
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-363 promotes gastric cancer cells proliferation by inhibiting FBW7 expression and was associated with chemo-resistance of gastric cancer cells. Silencing FBW7 largely phenocopied miR-363-induced resistance to chemotherapy agents and promoted proliferation in gastric cancer cells. In addition, an inverse correlation between miR-363 and FBW7 mRNA expression was observed in gastric cancer tissues.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Resistant Disease Gastric cancer [ICD-11: 2B72.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
HGC27 cells Gastric Homo sapiens (Human) CVCL_1279
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR-363 promotes gastric cancer cells proliferation by inhibiting FBW7 expression and was associated with chemo-resistance of gastric cancer cells. Silencing FBW7 largely phenocopied miR-363-induced resistance to chemotherapy agents and promoted proliferation in gastric cancer cells. In addition, an inverse correlation between miR-363 and FBW7 mRNA expression was observed in gastric cancer tissues.
Oxaliplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [5]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Oxaliplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell viability Activation hsa05200
NR2F1/AS1/miR363/ABCC1 signaling pathway Regulation hsa05206
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Transwell assay
Mechanism Description Both NR2F1-AS1 and ABCC1 were up-regulated in oxaliplatin-resistant HCC cells,and miR-363 expression was increased in Huh7/OXA and HepG2/OXA cells transfected with NR2F1-AS1 siRNA compared to empty vector-transfected cells.
References
Ref 1 miR-363 promotes proliferation and chemo-resistance of human gastric cancer via targeting of FBW7 ubiquitin ligase expression. Oncotarget. 2016 Jun 7;7(23):35284-92. doi: 10.18632/oncotarget.9169.
Ref 2 Downregulation of miR-363 increases drug resistance in cisplatin-treated HepG2 by dysregulating Mcl-1. Gene. 2015 Nov 1;572(1):116-122. doi: 10.1016/j.gene.2015.07.002. Epub 2015 Jul 2.
Ref 3 EMT-associated microRNAs and their roles in cancer stemness and drug resistance .Cancer Commun (Lond). 2021 Mar;41(3):199-217. doi: 10.1002/cac2.12138. Epub 2021 Jan 27. 10.1002/cac2.12138
Ref 4 MiR-363 inhibits cisplatin chemoresistance of epithelial ovarian cancer by regulating snail-induced epithelial-mesenchymal transition. BMB Rep. 2018 Sep;51(9):456-461. doi: 10.5483/BMBRep.2018.51.9.104.
Ref 5 LncRNA NR2F1-AS1 regulates hepatocellular carcinoma oxaliplatin resistance by targeting ABCC1 via miR-363. J Cell Mol Med. 2018 Jun;22(6):3238-3245. doi: 10.1111/jcmm.13605. Epub 2018 Mar 30.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.