Molecule Information
General Information of the Molecule (ID: Mol01466)
| Name |
hsa-mir-363
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 363
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR363
|
||||
| Gene ID | |||||
| Location |
chrX:134169378-134169452[-]
|
||||
| Sequence |
UGUUGUCGGGUGGAUCACGAUGCAAUUUUGAUGAGUAUCAUAGGAGAAAAAUUGCACGGU
AUCCAUCUGUAAACC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-363 promotes gastric cancer cells proliferation by inhibiting FBW7 expression and was associated with chemo-resistance of gastric cancer cells. Silencing FBW7 largely phenocopied miR-363-induced resistance to chemotherapy agents and promoted proliferation in gastric cancer cells. In addition, an inverse correlation between miR-363 and FBW7 mRNA expression was observed in gastric cancer tissues. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [2] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| miR363/Mcl-1 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Cisplatin-based chemotherapy decreased miR-363 expression in HCC patients. miR-363 expression was also lower in HepG2-R cells than in HepG2 cells, which indicated that the downregulation of miR-363 may be related to cisplatin resistance. overexpression of miR-363 by its mimics can effectively increase the sensitivity of cisplatin-resistant HepG2 cells to cisplatin-induced apoptosis. overexpression of miR-363 could inhibit the expression of Mcl-1 in HepG2-R cells, which implied the inverse correlation between the expression of miR-363 and Mcl-1. More importantly, enforced exogenous Mcl-1 significantly attenuated apoptosis induced by cisplatin. All these results support that Mcl-1 is the target of miR-363 which can enhance sensitivity of human cisplatin-resistant HCC cell cisplatin at least partially. | |||
| Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] | [3] | |||
| Resistant Disease | Epithelial ovarian cancer [ICD-11: 2B5D.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Mechanism Description | Down-regulation of miR-363 led to cisplatin resistance in the epithelial ovarian cancer. | |||
| Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] | [3] | |||
| Resistant Disease | Epithelial ovarian cancer [ICD-11: 2B5D.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Mechanism Description | Down-regulation of miR-363 led to cisplatin resistance in the epithelial ovarian cancer. | |||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [4] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell viability | Activation | hsa05200 | |
| In Vitro Model | A2780CP cells | Ovary | Homo sapiens (Human) | CVCL_0135 |
| A2780s cells | Ovary | Homo sapiens (Human) | CVCL_4863 | |
| C13 cells | Ovary | Homo sapiens (Human) | CVCL_0114 | |
| OV2008 cells | Ovary | Homo sapiens (Human) | CVCL_0473 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Snail overexpression could significantly attenuate miR-363-suppressed cisplatin resistance of EOC cells, suggesting that miR-363-regulated cisplatin resistance is mediated by snail-induced EMT in EOC cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-363 promotes gastric cancer cells proliferation by inhibiting FBW7 expression and was associated with chemo-resistance of gastric cancer cells. Silencing FBW7 largely phenocopied miR-363-induced resistance to chemotherapy agents and promoted proliferation in gastric cancer cells. In addition, an inverse correlation between miR-363 and FBW7 mRNA expression was observed in gastric cancer tissues. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-363 promotes gastric cancer cells proliferation by inhibiting FBW7 expression and was associated with chemo-resistance of gastric cancer cells. Silencing FBW7 largely phenocopied miR-363-induced resistance to chemotherapy agents and promoted proliferation in gastric cancer cells. In addition, an inverse correlation between miR-363 and FBW7 mRNA expression was observed in gastric cancer tissues. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [5] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
| Cell viability | Activation | hsa05200 | ||
| NR2F1/AS1/miR363/ABCC1 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Transwell assay | |||
| Mechanism Description | Both NR2F1-AS1 and ABCC1 were up-regulated in oxaliplatin-resistant HCC cells,and miR-363 expression was increased in Huh7/OXA and HepG2/OXA cells transfected with NR2F1-AS1 siRNA compared to empty vector-transfected cells. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
