Molecule Information

General Information of the Molecule (ID: Mol01465)

• Name: hsa-mir-361 ,Homo sapiens
• Synonyms: microRNA 361
• Molecule Type: Precursor miRNA
• Gene Name: MIR361
• Gene ID: 494323
• Location: chrX:85903636-85903707[-]
• Sequence:
  GGAGCUUAUCAGAAUCUCCAGGGGUACUUUAUAAUUUCAAAAAGUCCCCCAGGUGUGAUU
  CUGAUUUGCUUC
• Ensembl ID: ENSG00000199051
• HGNC ID: HGNC:31867
• Precursor Accession: MI0000760

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 8 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [2]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR-361-3p/ABCC1; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Western blot; Dual-luciferase reporter assay
• Experiment for Drug Resistance: MTT assay; Cell proliferation and apoptosis assays
• Mechanism Description: MiR-361-3p suppressed ABCC1 expression by binding to ABCC1 3'UTR, and miR-361-3p-mediated inhibition of ABCC1 affected the growth, invasion, migration, apoptosis and DDP sensitivity of H1299/DDP and A549/DDP cells

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qRT-PCR; Western blot; Dual luciferase assay
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Increased miR-34a expression may therefore be able to inhibit docetaxel activity by arresting cells in G1 phase.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Methotrexate

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [5]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Methotrexate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• Experiment for Molecule Alteration: qRT-PCR; Microarrays assay; Gene expression levels analysis
• Experiment for Drug Resistance: Apoptosis assay; Cell viability assay
• Mechanism Description: MiRNA microarrays were performed with the aim to find differentially expressed miRNAs in HT29 resistant cells compared to their sensitive counterparts. 10 miRNAs fulfilled these criteria.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [6]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: BLACAT1/miR361/ABCB1 signaling pathway; Regulation; N.A.
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay; Transwell assay
• Mechanism Description: BLACAT1 accelerates the oxaliplatin-resistance of gastric cancer via promoting ABCB1 protein expression by targeting miR-361.

Paclitaxel

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [7]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell cycle pathways; Regulation; N.A.
• In Vitro Model: H1993 cells; Lymph node; Homo sapiens (Human); CVCL_1512
• In Vitro Model: H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• Experiment for Molecule Alteration: qRT-PCR; Western blot
• Experiment for Drug Resistance: Cell viability assay; Colony formation assay; Cell cycle analysis; Cell apoptosis and growth rate assays
• Mechanism Description: We demonstrated that two of the miRNA inhibitors (miR-133a/b and miR-361-3p) decrease cell survival by activating caspase-3/7-dependent apoptotic pathways and inducing cell cycle arrest in S phase.We demonstrated that two of the miRNA inhibitors (miR-133a/b and miR-361-3p) decrease cell survival by activating caspase-3/7-dependent apoptotic pathways and inducing cell cycle arrest in S phase.The mimic of miR-346, however, does not rescue the cytotoxic effect of the miR-346 inhibitor, suggesting that the cytotoxicity of the miR-346 inhibitor is most likely to be caused by off-target effects of the synthetic oligo rather than knocking down the expression of the endogenous miR-346.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [8]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 2: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 3: miRNA-34a is associated with docetaxel resistance in human breast cancer cells. Breast Cancer Res Treat. 2012 Jan;131(2):445-54. doi: 10.1007/s10549-011-1424-3. Epub 2011 Mar 12.
• Ref 4: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 5: Underexpression of miR-224 in methotrexate resistant human colon cancer cells. Biochem Pharmacol. 2011 Dec 1;82(11):1572-82. doi: 10.1016/j.bcp.2011.08.009. Epub 2011 Aug 16.
• Ref 6: Long noncoding RNA BLACAT1 modulates ABCB1 to promote oxaliplatin resistance of gastric cancer via sponging miR-361. Biomed Pharmacother. 2018 Mar;99:832-838. doi: 10.1016/j.biopha.2018.01.130. Epub 2018 Feb 20.
• Ref 7: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 8: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.