Molecule Information
General Information of the Molecule (ID: Mol01465)
Name |
hsa-mir-361
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 361
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR361
|
||||
Gene ID | |||||
Location |
chrX:85903636-85903707[-]
|
||||
Sequence |
GGAGCUUAUCAGAAUCUCCAGGGGUACUUUAUAAUUUCAAAAAGUCCCCCAGGUGUGAUU
CUGAUUUGCUUC Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [1] | |||
Resistant Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Resistant Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | BLACAT1/miR361/ABCB1 signaling pathway | Regulation | hsa05206 | |
Cell apoptosis | Inhibition | hsa04210 | ||
Cell invasion | Activation | hsa05200 | ||
Cell viability | Activation | hsa05200 | ||
In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay; Transwell assay | |||
Mechanism Description | BLACAT1 accelerates the oxaliplatin-resistance of gastric cancer via promoting ABCB1 protein expression by targeting miR-361. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.