Molecule Information

General Information of the Molecule (ID: Mol01463)

• Name: hsa-mir-130b ,Homo sapiens
• Synonyms: microRNA 130b
• Molecule Type: Precursor miRNA
• Gene Name: MIR130B
• Gene ID: 406920
• Location: chr22:21653304-21653385[+]
• Sequence:
  GGCCUGCCCGACACUCUUUCCCUGUUGCACUACUAUAGGCCGCUGGGAAGCAGUGCAAUG
  AUGAAAGGGCAUCGGUCAGGUC
• Ensembl ID: ENSG00000283871
• HGNC ID: HGNC:31515
• Precursor Accession: MI0000748

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [1]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• In Vitro Model: DLD-1 cells; Colon; Homo sapiens (Human); CVCL_0248
• In Vitro Model: KM12C cells; Colon; Homo sapiens (Human); CVCL_9547
• Experiment for Molecule Alteration: MiRNA microarray; qRT-PCR; mRNA immunoprecipitation
• Experiment for Drug Resistance: Cell proliferation assay; Flow cytometry
• Mechanism Description: We revealed up-regulation of miR-19b in response to 5-FU and potential targets of miR-19b mediating the cell cycle under treatment with 5-FU.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.5] [2]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Activation; hsa04310
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H446 cells; Lung; Homo sapiens (Human); CVCL_1562
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay; Flow cytometry assay
• Mechanism Description: microRNA-130b targets PTEN to induce resistance to cisplatin in lung cancer cells by activating Wnt/beta-catenin pathway.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [3]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: CSF-1 expression was negatively associated with miR-130b level in ovarian tissues and cell lines. miR-130b modulates MDR by targeting CSF-1, Down-regulation of miR-130b promotes the development of multidrug resistant ovarian cancer partially by targeting the 3'-UTR of CSF-1.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Activation; hsa04151
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7/ADR cells; Breast; Homo sapiens (Human); CVCL_1452
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Colony Formation assay; FITC Annexin V Apoptosis assay
• Mechanism Description: microRNA-130b targets PTEN to mediate drug resistance and proliferation of breast cancer cells via the PI3k/Akt signaling pathway. PTEN acted as a tumor inhibitor gene by specifically reversely regulating the PI3k/Akt pathway, miR130b may activate PI3k/Akt signaling by silencing PTEN.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [ICD-11: 2C94.0] [5]

• Resistant Disease: Bladder cancer [ICD-11: 2C94.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: J82 cells; Bladder; Homo sapiens (Human); CVCL_0359
• In Vitro Model: UM-UC-3 cells; Bladder; Homo sapiens (Human); CVCL_1783
• In Vitro Model: RT4 cells; Bladder; Homo sapiens (Human); CVCL_0036
• In Vitro Model: RT112 cells; Bladder; Homo sapiens (Human); CVCL_1670
• Experiment for Molecule Alteration: Western blot; Microarray Analysis; qRT-PCR
• Experiment for Drug Resistance: Proliferation Assay
• Mechanism Description: Within this group, let-7b and let-7i exhibited decreased expression, while miR-1290 and miR-138 displayed increased expression levels in gemcitabine-resistant cells

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [3]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: CSF-1 expression was negatively associated with miR-130b level in ovarian tissues and cell lines. miR-130b modulates MDR by targeting CSF-1, Down-regulation of miR-130b promotes the development of multidrug resistant ovarian cancer partially by targeting the 3'-UTR of CSF-1.

Sorafenib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [7]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: RT-PCR; Western blot; Luciferase assay
• Experiment for Drug Resistance: Cytotoxicity assay; Apoptosis assays
• Mechanism Description: Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis.

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [8]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: Caki-1 cells; Kidney; Homo sapiens (Human); CVCL_0234
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-130b promoted cell growth and was associated with sunitinib resistance through regulating PTEN expression.

References

• Ref 1: Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.
• Ref 2: MicroRNA-130b targets PTEN to induce resistance to cisplatin in lung cancer cells by activating Wnt/Beta-catenin pathway. Cell Biochem Funct. 2018 Jun;36(4):194-202. doi: 10.1002/cbf.3331. Epub 2018 Apr 13.
• Ref 3: Epigenetic silencing of miR-130b in ovarian cancer promotes the development of multidrug resistance by targeting colony-stimulating factor 1. Gynecol Oncol. 2012 Feb;124(2):325-34. doi: 10.1016/j.ygyno.2011.10.013. Epub 2011 Oct 15.
• Ref 4: MicroRNA-130b targets PTEN to mediate drug resistance and proliferation of breast cancer cells via the PI3K/Akt signaling pathway. Sci Rep. 2017 Feb 6;7:41942. doi: 10.1038/srep41942.
• Ref 5: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 6: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
• Ref 7: Downregulation of miR-21 enhances chemotherapeutic effect of taxol in breast carcinoma cells. Technol Cancer Res Treat. 2010 Feb;9(1):77-86. doi: 10.1177/153303461000900109.
• Ref 8: miR-130b Promotes Sunitinib Resistance through Regulation of PTEN in Renal Cell Carcinoma. Oncology. 2019;97(3):164-172. doi: 10.1159/000500605. Epub 2019 Jun 13.