Molecule Information
General Information of the Molecule (ID: Mol01463)
Name |
hsa-mir-130b
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 130b
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR130B
|
||||
Gene ID | |||||
Location |
chr22:21653304-21653385[+]
|
||||
Sequence |
GGCCUGCCCGACACUCUUUCCCUGUUGCACUACUAUAGGCCGCUGGGAAGCAGUGCAAUG
AUGAAAGGGCAUCGGUCAGGUC Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung cancer | [1] | |||
Resistant Disease | Lung cancer [ICD-11: 2C25.5] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
Wnt/Beta-catenin signaling pathway | Activation | hsa04310 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
H446 cells | Lung | Homo sapiens (Human) | CVCL_1562 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTS assay; Flow cytometry assay | |||
Mechanism Description | microRNA-130b targets PTEN to induce resistance to cisplatin in lung cancer cells by activating Wnt/beta-catenin pathway. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [2] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | CSF-1 expression was negatively associated with miR-130b level in ovarian tissues and cell lines. miR-130b modulates MDR by targeting CSF-1, Down-regulation of miR-130b promotes the development of multidrug resistant ovarian cancer partially by targeting the 3'-UTR of CSF-1. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [3] | |||
Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
PI3K/AKT signaling pathway | Activation | hsa04151 | ||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
MCF-7/ADR cells | Breast | Homo sapiens (Human) | CVCL_1452 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Colony Formation assay; FITC Annexin V Apoptosis assay | |||
Mechanism Description | microRNA-130b targets PTEN to mediate drug resistance and proliferation of breast cancer cells via the PI3k/Akt signaling pathway. PTEN acted as a tumor inhibitor gene by specifically reversely regulating the PI3k/Akt pathway, miR130b may activate PI3k/Akt signaling by silencing PTEN. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Ovarian cancer | [2] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Paclitaxel | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | CSF-1 expression was negatively associated with miR-130b level in ovarian tissues and cell lines. miR-130b modulates MDR by targeting CSF-1, Down-regulation of miR-130b promotes the development of multidrug resistant ovarian cancer partially by targeting the 3'-UTR of CSF-1. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Renal cell carcinoma | [4] | |||
Resistant Disease | Renal cell carcinoma [ICD-11: 2C90.0] | |||
Resistant Drug | Sunitinib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
In Vitro Model | Caki-1 cells | Kidney | Homo sapiens (Human) | CVCL_0234 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-130b promoted cell growth and was associated with sunitinib resistance through regulating PTEN expression. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.