Molecule Information

General Information of the Molecule (ID: Mol01463)

Name	hsa-mir-130b ,Homo sapiens
Synonyms	microRNA 130b Click to Show/Hide
Molecule Type	Precursor miRNA
Gene Name	MIR130B
Gene ID	406920
Location	chr22:21653304-21653385[+]
Sequence	GGCCUGCCCGACACUCUUUCCCUGUUGCACUACUAUAGGCCGCUGGGAAGCAGUGCAAUG AUGAAAGGGCAUCGGUCAGGUC Click to Show/Hide
Ensembl ID	ENSG00000283871
HGNC ID	HGNC:31515
Precursor Accession	MI0000748
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

4 drug(s) in total

Click to Show/Hide the Full List of Drugs

Cisplatin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.5]				[1]
Resistant Disease	Lung cancer [ICD-11: 2C25.5]			Disease Info
Resistant Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	Cell proliferation		Activation	hsa05200
	Wnt/Beta-catenin signaling pathway		Activation	hsa04310
In Vitro Model	A549 cells	Lung	Homo sapiens (Human)	CVCL_0023
	H446 cells	Lung	Homo sapiens (Human)	CVCL_1562
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTS assay; Flow cytometry assay
Mechanism Description	microRNA-130b targets PTEN to induce resistance to cisplatin in lung cancer cells by activating Wnt/beta-catenin pathway.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0]				[2]
Sensitive Disease	Ovarian cancer [ICD-11: 2C73.0]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
In Vitro Model	SkOV3 cells	Ovary	Homo sapiens (Human)	CVCL_0532
	A2780 cells	Ovary	Homo sapiens (Human)	CVCL_0134
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	CSF-1 expression was negatively associated with miR-130b level in ovarian tissues and cell lines. miR-130b modulates MDR by targeting CSF-1, Down-regulation of miR-130b promotes the development of multidrug resistant ovarian cancer partially by targeting the 3'-UTR of CSF-1.

Doxorubicin

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3]				[3]
Resistant Disease	Breast cancer [ICD-11: 2C60.3]			Disease Info
Resistant Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell apoptosis		Inhibition	hsa04210
	PI3K/AKT signaling pathway		Activation	hsa04151
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	MCF-7/ADR cells	Breast	Homo sapiens (Human)	CVCL_1452
In Vivo Model	Nude mouse xenograft model			Mus musculus
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay; Colony Formation assay; FITC Annexin V Apoptosis assay
Mechanism Description	microRNA-130b targets PTEN to mediate drug resistance and proliferation of breast cancer cells via the PI3k/Akt signaling pathway. PTEN acted as a tumor inhibitor gene by specifically reversely regulating the PI3k/Akt pathway, miR130b may activate PI3k/Akt signaling by silencing PTEN.

Paclitaxel

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0]				[2]
Sensitive Disease	Ovarian cancer [ICD-11: 2C73.0]			Disease Info
Sensitive Drug	Paclitaxel			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
In Vitro Model	SkOV3 cells	Ovary	Homo sapiens (Human)	CVCL_0532
	A2780 cells	Ovary	Homo sapiens (Human)	CVCL_0134
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	CSF-1 expression was negatively associated with miR-130b level in ovarian tissues and cell lines. miR-130b modulates MDR by targeting CSF-1, Down-regulation of miR-130b promotes the development of multidrug resistant ovarian cancer partially by targeting the 3'-UTR of CSF-1.

Sunitinib

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Renal cell carcinoma [ICD-11: 2C90.0]				[4]
Resistant Disease	Renal cell carcinoma [ICD-11: 2C90.0]			Disease Info
Resistant Drug	Sunitinib			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Identified from the Human Clinical Data
Cell Pathway Regulation	Cell proliferation		Activation	hsa05200
In Vitro Model	Caki-1 cells	Kidney	Homo sapiens (Human)	CVCL_0234
Experiment for Molecule Alteration	qRT-PCR
Experiment for Drug Resistance	MTT assay
Mechanism Description	miR-130b promoted cell growth and was associated with sunitinib resistance through regulating PTEN expression.

References

Ref 1	MicroRNA-130b targets PTEN to induce resistance to cisplatin in lung cancer cells by activating Wnt/Beta-catenin pathway. Cell Biochem Funct. 2018 Jun;36(4):194-202. doi: 10.1002/cbf.3331. Epub 2018 Apr 13.
Ref 2	Epigenetic silencing of miR-130b in ovarian cancer promotes the development of multidrug resistance by targeting colony-stimulating factor 1. Gynecol Oncol. 2012 Feb;124(2):325-34. doi: 10.1016/j.ygyno.2011.10.013. Epub 2011 Oct 15.
Ref 3	MicroRNA-130b targets PTEN to mediate drug resistance and proliferation of breast cancer cells via the PI3K/Akt signaling pathway. Sci Rep. 2017 Feb 6;7:41942. doi: 10.1038/srep41942.
Ref 4	miR-130b Promotes Sunitinib Resistance through Regulation of PTEN in Renal Cell Carcinoma. Oncology. 2019;97(3):164-172. doi: 10.1159/000500605. Epub 2019 Jun 13.