Molecule Information

General Information of the Molecule (ID: Mol01460)

• Name: hsa-mir-301 ,Homo sapiens
• Synonyms: microRNA 301a
• Molecule Type: Precursor miRNA
• Gene Name: MIR301A
• Gene ID: 407027
• Location: chr17:59151136-59151221[-]
• Sequence:
  ACUGCUAACGAAUGCUCUGACUUUAUUGCACUACUGUACUUUACAGCUAGCAGUGCAAUA
  GUAUUGUCAAAGCAUCUGAAAGCAGG
• Ensembl ID: ENSG00000207996
• HGNC ID: HGNC:31622
• Precursor Accession: MI0000745

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [1]

• Resistant Disease: Melanoma [ICD-11: 2C30.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: AKT/FAKT signaling pathway; Activation; hsa04151
• In Vitro Model: A375 cells; Skin; Homo sapiens (Human); CVCL_0132
• In Vitro Model: SkMEL1 cells; Skin; Homo sapiens (Human); CVCL_0068
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay; Annexin V-fluorescein isothiocyanate (FITC) apoptosis analysis; Wound scratch healing or transwell invasion assay
• Mechanism Description: PTEN can interact with AkT and FAk and inhibit their activity through their dephosphorylation, Akt and FAk signaling pathways are involved in miR301a/PTEN-promoting malignant phenotypes in MM cells, miR301a promotes MM progression via activation of Akt and FAk signaling pathways by down regulating PTEN.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [1]

• Resistant Disease: Melanoma [ICD-11: 2C30.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: AKT/FAKT signaling pathway; Activation; hsa04151
• In Vitro Model: A375 cells; Skin; Homo sapiens (Human); CVCL_0132
• In Vitro Model: SkMEL1 cells; Skin; Homo sapiens (Human); CVCL_0068
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay; Annexin V-fluorescein isothiocyanate (FITC) apoptosis analysis; Wound scratch healing or transwell invasion assay
• Mechanism Description: PTEN can interact with AkT and FAk and inhibit their activity through their dephosphorylation, Akt and FAk signaling pathways are involved in miR301a/PTEN-promoting malignant phenotypes in MM cells, miR301a promotes MM progression via activation of Akt and FAk signaling pathways by down regulating PTEN.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic carcinoma [2]

• Resistant Disease: Pancreatic carcinoma [ICD-11: 2C10.2]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: Capan-2 cells; Pancreas; Homo sapiens (Human); CVCL_0026
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Colorimetric methylene blue assay; Flow cytometry assay
• Mechanism Description: Gemcitabine-resistant Capan-2 and Panc-1 cells exhibited increased miR-301 expression, and miR-301 overepression can enhance apoptosis and inhibit cell invasiveness and exhibit strong gemcitabine resistance.

Disease Class: Pancreatic cancer [3]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT signaling pathway; Activation; hsa04151
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: HEK293T cells; Kidney; Homo sapiens (Human); CVCL_0063
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: AsPC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0152
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vitro Model: HPAF-II cells; Pancreatic; Homo sapiens (Human); CVCL_0313
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: miR-301a upregulation promoted resistance to gemcitabine under hypoxia through downregulation of TAp63.

References

• Ref 1: Expression of MicroRNA-301a and its Functional Roles in Malignant Melanoma. Cell Physiol Biochem. 2016;40(1-2):230-244. doi: 10.1159/000452540. Epub 2016 Nov 18.
• Ref 2: MicroRNA-200b and -301 are associated with gemcitabine response as biomarkers in pancreatic carcinoma cells. Int J Oncol. 2019 Mar;54(3):991-1000. doi: 10.3892/ijo.2019.4676. Epub 2019 Jan 7.
• Ref 3: miR-301a plays a pivotal role in hypoxia-induced gemcitabine resistance in pancreatic cancer. Exp Cell Res. 2018 Aug 1;369(1):120-128. doi: 10.1016/j.yexcr.2018.05.013. Epub 2018 May 23.