Molecule Information
General Information of the Molecule (ID: Mol01460)
Name |
hsa-mir-301
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 301a
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR301A
|
||||
Gene ID | |||||
Location |
chr17:59151136-59151221[-]
|
||||
Sequence |
ACUGCUAACGAAUGCUCUGACUUUAUUGCACUACUGUACUUUACAGCUAGCAGUGCAAUA
GUAUUGUCAAAGCAUCUGAAAGCAGG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Melanoma | [1] | |||
Resistant Disease | Melanoma [ICD-11: 2C30.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | AKT/FAKT signaling pathway | Activation | hsa04151 | |
In Vitro Model | A375 cells | Skin | Homo sapiens (Human) | CVCL_0132 |
SkMEL1 cells | Skin | Homo sapiens (Human) | CVCL_0068 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Colony formation assay; Annexin V-fluorescein isothiocyanate (FITC) apoptosis analysis; Wound scratch healing or transwell invasion assay | |||
Mechanism Description | PTEN can interact with AkT and FAk and inhibit their activity through their dephosphorylation, Akt and FAk signaling pathways are involved in miR301a/PTEN-promoting malignant phenotypes in MM cells, miR301a promotes MM progression via activation of Akt and FAk signaling pathways by down regulating PTEN. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Melanoma | [1] | |||
Resistant Disease | Melanoma [ICD-11: 2C30.0] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | AKT/FAKT signaling pathway | Activation | hsa04151 | |
In Vitro Model | A375 cells | Skin | Homo sapiens (Human) | CVCL_0132 |
SkMEL1 cells | Skin | Homo sapiens (Human) | CVCL_0068 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Colony formation assay; Annexin V-fluorescein isothiocyanate (FITC) apoptosis analysis; Wound scratch healing or transwell invasion assay | |||
Mechanism Description | PTEN can interact with AkT and FAk and inhibit their activity through their dephosphorylation, Akt and FAk signaling pathways are involved in miR301a/PTEN-promoting malignant phenotypes in MM cells, miR301a promotes MM progression via activation of Akt and FAk signaling pathways by down regulating PTEN. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Pancreatic carcinoma | [2] | |||
Resistant Disease | Pancreatic carcinoma [ICD-11: 2C10.2] | |||
Resistant Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell invasion | Inhibition | hsa05200 | ||
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 |
Capan-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0026 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
Colorimetric methylene blue assay; Flow cytometry assay | |||
Mechanism Description | Gemcitabine-resistant Capan-2 and Panc-1 cells exhibited increased miR-301 expression, and miR-301 overepression can enhance apoptosis and inhibit cell invasiveness and exhibit strong gemcitabine resistance. | |||
Disease Class: Pancreatic cancer | [3] | |||
Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
Resistant Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | AKT signaling pathway | Activation | hsa04151 | |
Cell viability | Activation | hsa05200 | ||
In Vitro Model | HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 |
BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 | |
MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 | |
PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 | |
AsPC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0152 | |
SW1990 cells | Pancreas | Homo sapiens (Human) | CVCL_1723 | |
HPAF-II cells | Pancreatic | Homo sapiens (Human) | CVCL_0313 | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
Mechanism Description | miR-301a upregulation promoted resistance to gemcitabine under hypoxia through downregulation of TAp63. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.