General Information of the Molecule (ID: Mol01458)
Name
hsa-mir-302a ,Homo sapiens
Synonyms
microRNA 302a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR302A
Gene ID
407028
Location
chr4:112648183-112648251[-]
Sequence
CCACCACUUAAACGUGGAUGUACUUGCUUUGAAACUAAAGAAGUAAGUGCUUCCAUGUUU
UGGUGAUGG
    Click to Show/Hide
Ensembl ID
ENSG00000207927
HGNC ID
HGNC:31623
Precursor Accession
MI0000738
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Testicular embryonal carcinoma [ICD-11: 2C80.1] [1]
Sensitive Disease Testicular embryonal carcinoma [ICD-11: 2C80.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model NCCIT cells Embryo Homo sapiens (Human) CVCL_1451
NT2 cells Prostate Homo sapiens (Human) CVCL_JA57
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Up-regulation of miR-302a significantly increased the sensitivity of NT2 cells to cisplatin by enhancing cisplatin-induced G2/M phase arrest and the subsequent progression to apoptosis.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
ERK signaling pathway Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description MAP/ERk kinase kinase 1 (MEkk1) as a direct and functional target of miR-302. miR-302 showed combinatorial effects on MkEE1 repression and MEkk1-mediated ERk pathway. The suppression of P-gp by miR-302 was reversed by MEkk1 overexpression. miR-302 cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein by targeting MEkk1 of ERk pathway.
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [3]
Sensitive Disease Colon cancer [ICD-11: 2B90.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Trypan blue dye-exclusion assay; Annexin V-FITC apoptosis assay; Flow cytometer
Mechanism Description Both miR 302a and si IGF 1R inhibited Akt signaling. MiR 302a targeted IGF 1R and enhanced 5 FU induced cell death and viability inhibition in human colon cancer cells.
Mitoxantrone
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [4]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Mitoxantrone
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description miR-302 inhibits BCRP expression via targeting the 3'-UTR of BCRP mRNA. miR-302 members may cooperatively downregulate BCRP expression to increase chemosensitivity of breast cancer cells. miR-302 gene cluster may be a potential target for reversing BCRP-mediated chemoresistance in breast cancer.
References
Ref 1 MicroRNA-302a sensitizes testicular embryonal carcinoma cells to cisplatin-induced cell death. J Cell Physiol. 2013 Dec;228(12):2294-304. doi: 10.1002/jcp.24394.
Ref 2 MiR-302a/b/c/d cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein(P-gp) by targeting MAP/ERK kinase kinase 1 (MEKK1). J Exp Clin Cancer Res. 2016 Feb 3;35:25. doi: 10.1186/s13046-016-0300-8.
Ref 3 MicroRNA-302a enhances 5-fluorouracil-induced cell death in human colon cancer cells. Oncol Rep. 2017 Jan;37(1):631-639. doi: 10.3892/or.2016.5237. Epub 2016 Nov 8.
Ref 4 miR-302a/b/c/d cooperatively inhibit BCRP expression to increase drug sensitivity in breast cancer cells. Gynecol Oncol. 2016 Jun;141(3):592-601. doi: 10.1016/j.ygyno.2015.11.034. Epub 2015 Nov 28.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.