Molecule Information

General Information of the Molecule (ID: Mol01458)

• Name: hsa-mir-302a ,Homo sapiens
• Synonyms: microRNA 302a
• Molecule Type: Precursor miRNA
• Gene Name: MIR302A
• Gene ID: 407028
• Location: chr4:112648183-112648251[-]
• Sequence:
  CCACCACUUAAACGUGGAUGUACUUGCUUUGAAACUAAAGAAGUAAGUGCUUCCAUGUUU
  UGGUGAUGG
• Ensembl ID: ENSG00000207927
• HGNC ID: HGNC:31623
• Precursor Accession: MI0000738

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Testicular embryonal carcinoma [1]

• Sensitive Disease: Testicular embryonal carcinoma [ICD-11: 2C80.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: NCCIT cells; Embryo; Homo sapiens (Human); CVCL_1451
• In Vitro Model: NT2 cells; Prostate; Homo sapiens (Human); CVCL_JA57
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Up-regulation of miR-302a significantly increased the sensitivity of NT2 cells to cisplatin by enhancing cisplatin-induced G2/M phase arrest and the subsequent progression to apoptosis.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: ERK signaling pathway; Regulation; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: MAP/ERk kinase kinase 1 (MEkk1) as a direct and functional target of miR-302. miR-302 showed combinatorial effects on MkEE1 repression and MEkk1-mediated ERk pathway. The suppression of P-gp by miR-302 was reversed by MEkk1 overexpression. miR-302 cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein by targeting MEkk1 of ERk pathway.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [3]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: PI3K/AKT signaling pathway; Inhibition; hsa04151
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Trypan blue dye-exclusion assay; Annexin V-FITC apoptosis assay; Flow cytometer
• Mechanism Description: Both miR 302a and si IGF 1R inhibited Akt signaling. MiR 302a targeted IGF 1R and enhanced 5 FU induced cell death and viability inhibition in human colon cancer cells.

Mitoxantrone

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [4]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Mitoxantrone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-302 inhibits BCRP expression via targeting the 3'-UTR of BCRP mRNA. miR-302 members may cooperatively downregulate BCRP expression to increase chemosensitivity of breast cancer cells. miR-302 gene cluster may be a potential target for reversing BCRP-mediated chemoresistance in breast cancer.

References

• Ref 1: MicroRNA-302a sensitizes testicular embryonal carcinoma cells to cisplatin-induced cell death. J Cell Physiol. 2013 Dec;228(12):2294-304. doi: 10.1002/jcp.24394.
• Ref 2: MiR-302a/b/c/d cooperatively sensitizes breast cancer cells to adriamycin via suppressing P-glycoprotein(P-gp) by targeting MAP/ERK kinase kinase 1 (MEKK1). J Exp Clin Cancer Res. 2016 Feb 3;35:25. doi: 10.1186/s13046-016-0300-8.
• Ref 3: MicroRNA-302a enhances 5-fluorouracil-induced cell death in human colon cancer cells. Oncol Rep. 2017 Jan;37(1):631-639. doi: 10.3892/or.2016.5237. Epub 2016 Nov 8.
• Ref 4: miR-302a/b/c/d cooperatively inhibit BCRP expression to increase drug sensitivity in breast cancer cells. Gynecol Oncol. 2016 Jun;141(3):592-601. doi: 10.1016/j.ygyno.2015.11.034. Epub 2015 Nov 28.