Molecule Information

General Information of the Molecule (ID: Mol01457)

• Name: hsa-mir-200a ,Homo sapiens
• Synonyms: microRNA 200a
• Molecule Type: Precursor miRNA
• Gene Name: MIR200A
• Gene ID: 406983
• Location: chr1:1167863-1167952[+]
• Sequence:
  CCGGGCCCCUGUGAGCAUCUUACCGGACAGUGCUGGAUUUCCCAGCUUGACUCUAACACU
  GUCUGGUAACGAUGUUCAAAGGUGACCCGC
• Ensembl ID: ENSG00000207607
• HGNC ID: HGNC:31578
• Precursor Accession: MI0000737

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 11 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [ICD-11: 2C94.0] [2]

• Resistant Disease: Bladder cancer [ICD-11: 2C94.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• In Vitro Model: J82 cells; Bladder; Homo sapiens (Human); CVCL_0359
• In Vitro Model: HT1376 cells; Bladder; Homo sapiens (Human); CVCL_1292
• Experiment for Molecule Alteration: RT-qPCR; DNA methylation analysis; ChIP-PCR
• Experiment for Drug Resistance: Cell proliferation assay
• Mechanism Description: We detected significant downregulation of miR-200 family members, including miR-200b, -200a and -429 in CDDP-resistant cells. The simultaneous reduction of these miRNAs is thought to be associated with increased DNA methylation of their upstream CpG islands.

Cyclophosphamide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [ICD-11: 2C60.3] [3]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Cyclophosphamide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: Tri-PyMT cells; Breast; Homo sapiens (Human); N.A.
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CellTiter-Glo luminescent cell viability assay
• Mechanism Description: Inhibiting EMT by overexpressing miR-200 did not impact lung metastasis development. However, EMT cells significantly contribute to recurrent lung metastasis formation after chemotherapy. These cells survived cyclophosphamide treatment due to reduced proliferation, apoptotic tolerance, and elevated expression of chemoresistance-related genes. Overexpression of miR-200 abrogated this resistance.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Breast cancer patients; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR
• Mechanism Description: In the validation set, miR-200a (area under the curve = 0.881, sensitivity = 94.1%, specificity = 76.7%) and miR-210 (area under the curve = 0.851, sensitivity = 88.2%, specificity = 72.1%) showed high diagnostic accuracy for distinguishing sensitive group from resistant group. Furthermore, the plasma level of miR-200a was significantly associated with the stage in surgery (P = .035), and the high level of miR-210 expression was associated with internal organ metastasis (liver, lung, and brain; P = .024). Conclusions: Plasma miR-200a and miR-210 could be effective biomarkers for the prediction of chemotherapy resistance in metastatic breast cancer patients.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MET pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR; Western Immunoblotting; Luciferase Reporter Assay; Immunocytochemistry and Immunofluorescence; miRNA Microarray Expression Analysis
• Experiment for Drug Resistance: CellTiter-Blue Cell Viability Assay (Promega)
• Mechanism Description: Furthermore, we show that microRNA-451 regulates the expression of multidrug resistance 1 gene. More importantly, transfection of the MCF-7/DOX-resistant cells with microRNA-451 resulted in the increased sensitivity of cells to DOX, indicating that correction of altered expression of miRNA may have significant implications for therapeutic strategies aiming to overcome cancer cell resistance.

Erlotinib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [5]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: TGF-Beta/miR200/MIG6 signaling pathway; Inhibition; hsa05206
• In Vitro Model: Calu3 cells; Lung; Homo sapiens (Human); CVCL_0609
• In Vitro Model: H292 cells; Lung; Homo sapiens (Human); CVCL_0455
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• In Vitro Model: NCl-H226 cells; Lung; Homo sapiens (Human); CVCL_1544
• In Vitro Model: NCl-H1437 cells; Lung; Homo sapiens (Human); CVCL_1472
• In Vitro Model: H1703 cells; Lung; Homo sapiens (Human); CVCL_1490
• In Vitro Model: H23 cells; Lung; Homo sapiens (Human); CVCL_1547
• In Vitro Model: Calu6 cells; Lung; Homo sapiens (Human); CVCL_0236
• In Vitro Model: H1838 cells; Lung; Homo sapiens (Human); CVCL_1499
• In Vitro Model: H1915 cells; Lung; Homo sapiens (Human); CVCL_1505
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR; RT-PCR
• Experiment for Drug Resistance: Alamar Blue assay
• Mechanism Description: The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo.

Disease Class: Bladder cancer [ICD-11: 2C94.0] [5]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: TGF-Beta/miR200/MIG6 signaling pathway; Inhibition; hsa05206
• In Vitro Model: Calu3 cells; Lung; Homo sapiens (Human); CVCL_0609
• In Vitro Model: H292 cells; Lung; Homo sapiens (Human); CVCL_0455
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCI-H358 cells; Lung; Homo sapiens (Human); CVCL_1559
• In Vitro Model: NCl-H226 cells; Lung; Homo sapiens (Human); CVCL_1544
• In Vitro Model: NCl-H1437 cells; Lung; Homo sapiens (Human); CVCL_1472
• In Vitro Model: H1703 cells; Lung; Homo sapiens (Human); CVCL_1490
• In Vitro Model: H23 cells; Lung; Homo sapiens (Human); CVCL_1547
• In Vitro Model: Calu6 cells; Lung; Homo sapiens (Human); CVCL_0236
• In Vitro Model: H1838 cells; Lung; Homo sapiens (Human); CVCL_1499
• In Vitro Model: H1915 cells; Lung; Homo sapiens (Human); CVCL_1505
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR; RT-PCR
• Experiment for Drug Resistance: Alamar Blue assay
• Mechanism Description: The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo.

Gefitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.5] [6]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Gefitinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Colony formation assay
• Mechanism Description: LncRNA MALAT1 promoted the proliferation and gefitinib resistance of lung cancer cells by sponging miR-200a, which regulates expression of ZEB1 in the A549 cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [7]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• In Vitro Model: HCC827 cells; Lung; Homo sapiens (Human); CVCL_2063
• In Vitro Model: CCD-19Lu cells; Lung; Homo sapiens (Human); CVCL_2382
• In Vitro Model: H3255 cells; Lung; Homo sapiens (Human); CVCL_6831
• In Vitro Model: MRC-5 cells; Lung; Homo sapiens (Human); CVCL_0440
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: microRNA-200a directly targets and downregulates egfr and c-met to inhibit migration, invasion, and gefitinib resistance in non-small cell lung cancer.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [8]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: p73-mediated apoptosis signaling pathway; Inhibition; hsa04210
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: SkBR3 cells; Breast; Homo sapiens (Human); CVCL_0033
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: BT-549; Breast; Homo sapiens (Human); CVCL_1092
• In Vitro Model: MCF-10A; Breast; Homo sapiens (Human); CVCL_0598
• In Vitro Model: MDA-MB-436 cells; Breast; Homo sapiens (Human); CVCL_0623
• In Vitro Model: MDA-MB-453 cells; Breast; Homo sapiens (Human); CVCL_0418
• In Vitro Model: MDA-MB-468 cells; Breast; Homo sapiens (Human); CVCL_0419
• In Vitro Model: ZR-75-30 cells; Breast; Homo sapiens (Human); CVCL_1661
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: TUNEL assays
• Mechanism Description: microRNA-200a confers chemoresistance by antagonizing TP53INP1 and YAP1 in human breast cancer Inhibition of miR200a enhances gemcitabine chemosensitivity in resistance cancer cells. TP53INP1 and YAP1 are involved in the RNA damage-induced p73-mediated apoptosis.

Paclitaxel

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [9]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: OVCAR-3 cells; Ascites; Homo sapiens (Human); CVCL_0465
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: We demonstrated that upregulation miR-200a promoted proliferation and inhibited CSCs phenotype in OVCAR-3 ovarian cancer cell line, combined with cell cycle-targeting drug paclitaxel could effectively eliminate the "side effects" of proliferation, and showed evidences that this strategy may be promising for ovarian cancer treatment.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [10]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [11]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Curcumin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] [12]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Curcumin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: HepJ5 cells; Liver; Homo sapiens (Human); CVCL_RW48
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The overexpression ofmiR-200a/b in HepJ5 cells conferred enhanced resistance tocurcumin treatment compared with the control cells.

Clinical Trial Drug(s) 2 drug(s) in total

Hydroxycamptothecin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [13]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Hydroxycamptothecin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• Experiment for Molecule Alteration: MiRNA microarray profiling, qRT-PCR
• Experiment for Drug Resistance: A sulforhodamine B (SRB) assay
• Mechanism Description: MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs.

PD-0325901

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [14]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: PD-0325901
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MEK-EGFR-PI3K signalling pathway; Regulation; N.A.
• In Vitro Model: Panc1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: CFPAC1 cells; Pancreas; Homo sapiens (Human); CVCL_1119
• In Vitro Model: HPAF-II cells; Pancreatic; Homo sapiens (Human); CVCL_0313
• In Vitro Model: Capan-2 cells; Pancreas; Homo sapiens (Human); CVCL_0026
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vivo Model: Female 7- to 9-week-old Nu/Nu mice (Harlan, FoxN1/nude); Mus musculus
• Experiment for Molecule Alteration: Western blot
• Experiment for Drug Resistance: Cell growth inhibition assays; Apoptosis analysis
• Mechanism Description: Since miR200 family is known to be crucially involved in regulating epithelial-to-mesenchymal transition (EMT), our findings support the notion that molecular programs regulating differentiation status of PDA cells determine susceptibility to combinations of MEK and EGFR inhibitors.

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 2: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
• Ref 3: Epithelial-to-mesenchymal transition is not required for lung metastasis but contributes to chemoresistance. Nature. 2015 Nov 26;527(7579):472-6. doi: 10.1038/nature15748. Epub 2015 Nov 11.
• Ref 4: Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin. Mol Cancer Ther. 2008 Jul;7(7):2152-9. doi: 10.1158/1535-7163.MCT-08-0021.
• Ref 5: The TGFBeta-miR200-MIG6 pathway orchestrates the EMT-associated kinase switch that induces resistance to EGFR inhibitors. Cancer Res. 2014 Jul 15;74(14):3995-4005. doi: 10.1158/0008-5472.CAN-14-0110. Epub 2014 May 15.
• Ref 6: LncRNA MALAT1 Promotes Lung Cancer Proliferation and Gefitinib Resistance by Acting as a miR-200a Sponge. Arch Bronconeumol (Engl Ed). 2019 Dec;55(12):627-633. doi: 10.1016/j.arbres.2019.03.026. Epub 2019 May 24.
• Ref 7: MicroRNA-200a Targets EGFR and c-Met to Inhibit Migration, Invasion, and Gefitinib Resistance in Non-Small Cell Lung Cancer. Cytogenet Genome Res. 2015;146(1):1-8. doi: 10.1159/000434741. Epub 2015 Jul 11.
• Ref 8: MicroRNA-200a confers chemoresistance by antagonizing TP53INP1 and YAP1 in human breast cancer. BMC Cancer. 2018 Jan 12;18(1):74. doi: 10.1186/s12885-017-3930-0.
• Ref 9: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 10: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 11: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 12: MicroRNA-200a/b influenced the therapeutic effects of curcumin in hepatocellular carcinoma (HCC) cells. Tumour Biol. 2013 Oct;34(5):3209-18. doi: 10.1007/s13277-013-0891-z. Epub 2013 Jun 13.
• Ref 13: MicroRNA-141 confers resistance to cisplatin-induced apoptosis by targeting YAP1 in human esophageal squamous cell carcinoma. J Hum Genet. 2011 Apr;56(4):270-6. doi: 10.1038/jhg.2011.1. Epub 2011 Feb 3.
• Ref 14: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.