General Information of the Molecule (ID: Mol01457)
Name
hsa-mir-200a ,Homo sapiens
Synonyms
microRNA 200a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR200A
Gene ID
406983
Location
chr1:1167863-1167952[+]
Sequence
CCGGGCCCCUGUGAGCAUCUUACCGGACAGUGCUGGAUUUCCCAGCUUGACUCUAACACU
GUCUGGUAACGAUGUUCAAAGGUGACCCGC
    Click to Show/Hide
Ensembl ID
ENSG00000207607
HGNC ID
HGNC:31578
Precursor Accession
MI0000737
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cyclophosphamide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Breast cancer [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Cyclophosphamide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model Tri-PyMT cells Breast Homo sapiens (Human) N.A.
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CellTiter-Glo luminescent cell viability assay
Mechanism Description Inhibiting EMT by overexpressing miR-200 did not impact lung metastasis development. However, EMT cells significantly contribute to recurrent lung metastasis formation after chemotherapy. These cells survived cyclophosphamide treatment due to reduced proliferation, apoptotic tolerance, and elevated expression of chemoresistance-related genes. Overexpression of miR-200 abrogated this resistance.
Erlotinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Non-small cell lung cancer [2]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Erlotinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
TGF-Beta/miR200/MIG6 signaling pathway Inhibition hsa05206
In Vitro Model Calu3 cells Lung Homo sapiens (Human) CVCL_0609
H292 cells Lung Homo sapiens (Human) CVCL_0455
A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
H1299 cells Lung Homo sapiens (Human) CVCL_0060
NCI-H358 cells Lung Homo sapiens (Human) CVCL_1559
NCl-H226 cells Lung Homo sapiens (Human) CVCL_1544
NCl-H1437 cells Lung Homo sapiens (Human) CVCL_1472
H1703 cells Lung Homo sapiens (Human) CVCL_1490
H23 cells Lung Homo sapiens (Human) CVCL_1547
Calu6 cells Lung Homo sapiens (Human) CVCL_0236
H1838 cells Lung Homo sapiens (Human) CVCL_1499
H1915 cells Lung Homo sapiens (Human) CVCL_1505
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR; RT-PCR
Experiment for
Drug Resistance
Alamar Blue assay
Mechanism Description The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo.
Disease Class: Bladder cancer [2]
Sensitive Disease Bladder cancer [ICD-11: 2C94.0]
Sensitive Drug Erlotinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
TGF-Beta/miR200/MIG6 signaling pathway Inhibition hsa05206
In Vitro Model Calu3 cells Lung Homo sapiens (Human) CVCL_0609
H292 cells Lung Homo sapiens (Human) CVCL_0455
A549 cells Lung Homo sapiens (Human) CVCL_0023
H460 cells Lung Homo sapiens (Human) CVCL_0459
H1299 cells Lung Homo sapiens (Human) CVCL_0060
NCI-H358 cells Lung Homo sapiens (Human) CVCL_1559
NCl-H226 cells Lung Homo sapiens (Human) CVCL_1544
NCl-H1437 cells Lung Homo sapiens (Human) CVCL_1472
H1703 cells Lung Homo sapiens (Human) CVCL_1490
H23 cells Lung Homo sapiens (Human) CVCL_1547
Calu6 cells Lung Homo sapiens (Human) CVCL_0236
H1838 cells Lung Homo sapiens (Human) CVCL_1499
H1915 cells Lung Homo sapiens (Human) CVCL_1505
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR; RT-PCR
Experiment for
Drug Resistance
Alamar Blue assay
Mechanism Description The Mig6-mediated reduction of EGFR occurs concomitantly with a TGFbeta-induced EMT-associated kinase switch of tumor cells to an AkT-activated state, thereby leading to an EGFR-independent phenotype that is refractory to EGFR TkI. the ratio of the expression levels of Mig6 and miR200c is highly correlated with EMT and resistance to erlotinib. Moreover, analyses of primary tumor xenografts of patient-derived lung and pancreatic cancers carrying wild type EGFR showed that the tumor Mig6(mRNA)/miR200 ratio is inversely correlated with response to erlotinib in vivo.
Gefitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [3]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
Resistant Drug Gefitinib
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Colony formation assay
Mechanism Description LncRNA MALAT1 promoted the proliferation and gefitinib resistance of lung cancer cells by sponging miR-200a, which regulates expression of ZEB1 in the A549 cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [4]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Gefitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model H1975 cells Lung Homo sapiens (Human) CVCL_1511
HCC827 cells Lung Homo sapiens (Human) CVCL_2063
CCD-19Lu cells Lung Homo sapiens (Human) CVCL_2382
H3255 cells Lung Homo sapiens (Human) CVCL_6831
MRC-5 cells Lung Homo sapiens (Human) CVCL_0440
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description microRNA-200a directly targets and downregulates egfr and c-met to inhibit migration, invasion, and gefitinib resistance in non-small cell lung cancer.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [5]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation p73-mediated apoptosis signaling pathway Inhibition hsa04210
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
ZR75-1 cells Breast Homo sapiens (Human) CVCL_0588
BT-549 Breast Homo sapiens (Human) CVCL_1092
MCF-10A Breast Homo sapiens (Human) CVCL_0598
MDA-MB-436 cells Breast Homo sapiens (Human) CVCL_0623
MDA-MB-453 cells Breast Homo sapiens (Human) CVCL_0418
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
ZR-75-30 cells Breast Homo sapiens (Human) CVCL_1661
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
TUNEL assays
Mechanism Description microRNA-200a confers chemoresistance by antagonizing TP53INP1 and YAP1 in human breast cancer Inhibition of miR200a enhances gemcitabine chemosensitivity in resistance cancer cells. TP53INP1 and YAP1 are involved in the RNA damage-induced p73-mediated apoptosis.
Curcumin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [6]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Curcumin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
HepJ5 cells Liver Homo sapiens (Human) CVCL_RW48
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The overexpression ofmiR-200a/b in HepJ5 cells conferred enhanced resistance tocurcumin treatment compared with the control cells.
References
Ref 1 Epithelial-to-mesenchymal transition is not required for lung metastasis but contributes to chemoresistance. Nature. 2015 Nov 26;527(7579):472-6. doi: 10.1038/nature15748. Epub 2015 Nov 11.
Ref 2 The TGFBeta-miR200-MIG6 pathway orchestrates the EMT-associated kinase switch that induces resistance to EGFR inhibitors. Cancer Res. 2014 Jul 15;74(14):3995-4005. doi: 10.1158/0008-5472.CAN-14-0110. Epub 2014 May 15.
Ref 3 LncRNA MALAT1 Promotes Lung Cancer Proliferation and Gefitinib Resistance by Acting as a miR-200a Sponge. Arch Bronconeumol (Engl Ed). 2019 Dec;55(12):627-633. doi: 10.1016/j.arbres.2019.03.026. Epub 2019 May 24.
Ref 4 MicroRNA-200a Targets EGFR and c-Met to Inhibit Migration, Invasion, and Gefitinib Resistance in Non-Small Cell Lung Cancer. Cytogenet Genome Res. 2015;146(1):1-8. doi: 10.1159/000434741. Epub 2015 Jul 11.
Ref 5 MicroRNA-200a confers chemoresistance by antagonizing TP53INP1 and YAP1 in human breast cancer. BMC Cancer. 2018 Jan 12;18(1):74. doi: 10.1186/s12885-017-3930-0.
Ref 6 MicroRNA-200a/b influenced the therapeutic effects of curcumin in hepatocellular carcinoma (HCC) cells. Tumour Biol. 2013 Oct;34(5):3209-18. doi: 10.1007/s13277-013-0891-z. Epub 2013 Jun 13.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.