General Information of the Molecule (ID: Mol01456)
Name
hsa-mir-29c ,Homo sapiens
Synonyms
microRNA 29c
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR29C
Gene ID
407026
Location
chr1:207801852-207801939[-]
Sequence
AUCUCUUACACAGGCUGACCGAUUUCUCCUGGUGUUCAGAGUCUGUUUUUGUCUAGCACC
AUUUGAAAUCGGUUAUGAUGUAGGGGGA
    Click to Show/Hide
Ensembl ID
ENSG00000284214
HGNC ID
HGNC:31621
Precursor Accession
MI0000735
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
12 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [1]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model DLD-1 cells Colon Homo sapiens (Human) CVCL_0248
KM12C cells Colon Homo sapiens (Human) CVCL_9547
DLD-1 cells Colon Homo sapiens (Human) CVCL_0248
KM12C cells Colon Homo sapiens (Human) CVCL_9547
Experiment for
Molecule Alteration
MiRNA microarray; qRT-PCR; mRNA immunoprecipitation
Experiment for
Drug Resistance
Cell proliferation assay; Flow cytometry
Mechanism Description We revealed up-regulation of miR-19b in response to 5-FU and potential targets of miR-19b mediating the cell cycle under treatment with 5-FU.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Resistant Disease Ovarian cancer [ICD-11: 2C73.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
CP70 cells Ovary Homo sapiens (Human) CVCL_0135
HeyC2 cells Ovary Homo sapiens (Human) CVCL_X009
In Vivo Model NOD/SCID nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description Knockdown of miR-29a/b/c increased the ability of cells to escape cisplatin-induced cell death partly through upregulation of collagen type I alpha 1 (COL1A1) and increased the activation of extracellular signal-regulated kinase 1/2 and inactivation of glycogen synthase kinase 3 beta.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Nasopharyngeal carcinoma [ICD-11: 2B6B.0] [3]
Sensitive Disease Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model 5-8F cells Nasopharynx Homo sapiens (Human) CVCL_C528
CNE2 cells Nasopharynx Homo sapiens (Human) CVCL_6889
C666-1 cells Throat Homo sapiens (Human) CVCL_7949
CNE1 cells Throat Homo sapiens (Human) CVCL_6888
HONE1 cells Throat Homo sapiens (Human) CVCL_8706
6-10B cells Nasopharynx Homo sapiens (Human) CVCL_C529
SUNE-1 cells Nasopharynx Homo sapiens (Human) CVCL_6946
HNE-2 cells Nasopharynx Homo sapiens (Human) CVCL_FA07
In Vivo Model SCID-Beige nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-29c repressed expression of anti-apoptotic factors, Mcl-1 and Bcl-2 in NPC tissues and cell lines, cause the resstance to Cisplatin.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Nasopharyngeal cancer [ICD-11: 2B6B.1] [4]
Resistant Disease Nasopharyngeal cancer [ICD-11: 2B6B.1]
Resistant Drug Docetaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model C666-1 cells Throat Homo sapiens (Human) CVCL_7949
SUNE-1 cells Nasopharynx Homo sapiens (Human) CVCL_6946
In Vivo Model Balb/c athymic nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-29c was downregulated and integrin beta-1 (ITGB1) was upregulated in Taxol-resistant NPC cells compared with parental NPC cells. Further investigations using a TUNEL assay and BAX/BCL-2 ratio, found that overexpression of miR-29c and knockdown of ITGB1 can resensitize drug-resistant NPC cells to Taxol and promote apoptosis.
Disease Class: Nasopharyngeal cancer [ICD-11: 2B6B.1] [4]
Resistant Disease Nasopharyngeal cancer [ICD-11: 2B6B.1]
Resistant Drug Docetaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model C666-1 cells Throat Homo sapiens (Human) CVCL_7949
SUNE-1 cells Nasopharynx Homo sapiens (Human) CVCL_6946
In Vivo Model Balb/c athymic nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-29c was downregulated and integrin beta-1 (ITGB1) was upregulated in Taxol-resistant NPC cells compared with parental NPC cells. Further investigations using a TUNEL assay and BAX/BCL-2 ratio, found that overexpression of miR-29c and knockdown of ITGB1 can resensitize drug-resistant NPC cells to Taxol and promote apoptosis.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [5]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance
MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Etoposide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [6]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation MRP-1/ABCC1 Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR; Luciferase reporter assay; Western blot; Immunofluorescence staining
Experiment for
Drug Resistance
MTS assay
Mechanism Description Seventeen of miRNAs were differentially expressed in MCF-7/VP cells and their parent cells. The majority of these miRNAs exhibited increased expression levels, while miR-326, miR-429, miR-187, miR-7, and miR-92-2 showed decreased expression.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [7]
Sensitive Disease Pancreatic cancer [ICD-11: 2C10.3]
Sensitive Drug Gemcitabine
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell colony Inhibition hsa05200
Cell viability Inhibition hsa05200
In Vitro Model PANC-1 cells Pancreas Homo sapiens (Human) CVCL_0480
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description miR-29c targets USP22 and suppresses autophagy-mediated chemoresistance in a xenograft tumor model in vivo.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [8]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Resistant Drug Imatinib
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Mitochondrial apoptosis pathway Regulation N.A.
In Vitro Model HL-60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
In Vivo Model CML patients Homo sapiens
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR; Western blot
Experiment for
Drug Resistance
Cell viability assay
Mechanism Description The deregulation of miR-26a, miR-29c, miR-130b, miR-146a and their predicted targets C-IAP-1 and MCL-1 might be a mechanism of IM resistance since these genes are anti-apoptotic and may inhibit the BCR-ABL+ cell death increasing the leukemic cell survival.
Methotrexate
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [ICD-11: 2B51.0] [9]
Sensitive Disease Osteosarcoma [ICD-11: 2B51.0]
Sensitive Drug Methotrexate
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
U2OS cells Bone Homo sapiens (Human) CVCL_0042
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description Overexpression of miR-29c suppressed MTX resistance and promoted cell apoptosis by downregulating MCL1 expression.
Oxaliplatin
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [10]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Oxaliplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model Colorectal cancer cells Colon Homo sapiens (Human) N.A.
In Vivo Model Colorectal cancer patients Homo sapiens
Experiment for
Molecule Alteration
RT-PCR
Mechanism Description Specifically, significantly higher miR-29c-3p levels were observed in patients whose best response was disease control (response or stable disease) (p = .0051; Figure 4B).
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [11]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
T47D cells Breast Homo sapiens (Human) CVCL_0553
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description CDk6 knockdown attenuated the effects of miR-29c inhibition on paclitaxel cytotoxicity in breast cancer cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [11]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
T47D cells Breast Homo sapiens (Human) CVCL_0553
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description LINC00511 knockdown enhanced paclitaxel cytotoxicity in breast cancer cells by upregulating miR-29c.
Disease Class: Nasopharyngeal carcinoma [ICD-11: 2B6B.0] [4]
Sensitive Disease Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
In Vitro Model C666-1 cells Throat Homo sapiens (Human) CVCL_7949
SUNE-1 cells Nasopharynx Homo sapiens (Human) CVCL_6946
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Overexpression of miR-29c and knockdown of ITGB1 can resensitize drug-resistant NPC cells to Taxol and promote apoptosis.
Temozolomide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Malignant glioma [ICD-11: 2A00.2] [12]
Resistant Disease Malignant glioma [ICD-11: 2A00.2]
Resistant Drug Temozolomide
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation DNA damage repair signaling pathway Activation hsa03410
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
LN229 cells Brain Homo sapiens (Human) CVCL_0393
U373 cells Brain Homo sapiens (Human) CVCL_2219
U118 cells Brain Homo sapiens (Human) CVCL_0633
NHA Brain Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR; RIP assay; Dual luciferase reporter assay
Experiment for
Drug Resistance
MTT assay; BrdU incorporation assay
Mechanism Description XIST can amplify the chemoresistance of glioma cell lines to TMZ through directly targetting miR29c via SP1 and MGMT. XIST expression was up-regulated by miR29c inhibition while down-regulated by ectopic miR29, and XIST directly binds to miR29c to inhibit its expression, XIST and miR29c neatively regulates each other.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [ICD-11: 2A00.1] [12]
Sensitive Disease Glioma [ICD-11: 2A00.1]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation DNA mismatch repair pathway Regulation N.A.
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
LN229 cells Brain Homo sapiens (Human) CVCL_0393
U373 cells Brain Homo sapiens (Human) CVCL_2219
U118 cells Brain Homo sapiens (Human) CVCL_0633
NHA Brain Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration
qRT-PCR; RIP assay; Dual luciferase reporter assay
Experiment for
Drug Resistance
MTT assay; BrdU incorporation assay
Mechanism Description XIST can amplify the chemoresistance of glioma cell lines to TMZ through directly targetting miR29c via SP1 and MGMT. XIST/miR29c axis regulated glioma cell chemoresistance to TMZ through RNA mismatch repair pathway. XIST expression was up-regulated by miR29c inhibition while down-regulated by ectopic miR29, and XIST directly binds to miR29c to inhibit its expression, XIST and miR29c neatively regulates each other.
Disease Class: Glioma [ICD-11: 2A00.1] [13]
Sensitive Disease Glioma [ICD-11: 2A00.1]
Sensitive Drug Temozolomide
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
DNA mismatch repair pathway Regulation N.A.
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Ectopic expression of miR-29c increased TMZ sensitivity by inhibiting cell growth and promoting apoptosis in U251/TR cells.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [5]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Verapamil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance
MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
References
Ref 1 Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.
Ref 2 Downregulation of miR-29 contributes to cisplatin resistance of ovarian cancer cells. Int J Cancer. 2014 Feb 1;134(3):542-51. doi: 10.1002/ijc.28399. Epub 2013 Aug 28.
Ref 3 MicroRNA-29c enhances the sensitivities of human nasopharyngeal carcinoma to cisplatin-based chemotherapy and radiotherapy. Cancer Lett. 2013 Feb 1;329(1):91-8. doi: 10.1016/j.canlet.2012.10.033. Epub 2012 Nov 8.
Ref 4 miR-29c regulates resistance to paclitaxel in nasopharyngeal cancer by targeting ITGB1. Exp Cell Res. 2019 May 1;378(1):1-10. doi: 10.1016/j.yexcr.2019.02.012. Epub 2019 Feb 16.
Ref 5 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
Ref 6 Involvement of miR-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem Pharmacol. 2010 Mar 15;79(6):817-24. doi: 10.1016/j.bcp.2009.10.017. Epub 2009 Oct 31.
Ref 7 MicroRNA-29c Increases the Chemosensitivity of Pancreatic Cancer Cells by Inhibiting USP22 Mediated Autophagy. Cell Physiol Biochem. 2018;47(2):747-758. doi: 10.1159/000490027. Epub 2018 May 22.
Ref 8 Overcoming acquired BRAF inhibitor resistance in melanoma via targeted inhibition of Hsp90 with ganetespibMol Cancer Ther. 2014 Feb;13(2):353-63. doi: 10.1158/1535-7163.MCT-13-0481. Epub 2014 Jan 7.
Ref 9 miR-29 Family Inhibits Resistance to Methotrexate and Promotes Cell Apoptosis by Targeting COL3A1 and MCL1 in Osteosarcoma. Med Sci Monit. 2018 Dec 6;24:8812-8821. doi: 10.12659/MSM.911972.
Ref 10 MicroRNA-212-3p inhibits paclitaxel resistance through regulating epithelial-mesenchymal transition, migration and invasion by targeting ZEB2 in human hepatocellular carcinoma. Oncol Lett. 2020 Oct 20(4):23
Ref 11 LINC00511 knockdown enhances paclitaxel cytotoxicity in breast cancer via regulating miR-29c/CDK6 axis. Life Sci. 2019 Jul 1;228:135-144. doi: 10.1016/j.lfs.2019.04.063. Epub 2019 May 7.
Ref 12 LncRNA-XIST interacts with miR-29c to modulate the chemoresistance of glioma cell to TMZ through DNA mismatch repair pathway. Biosci Rep. 2017 Sep 7;37(5):BSR20170696. doi: 10.1042/BSR20170696. Print 2017 Oct 31.
Ref 13 miR-29c contribute to glioma cells temozolomide sensitivity by targeting O6-methylguanine-DNA methyltransferases indirectely. Oncotarget. 2016 Aug 2;7(31):50229-50238. doi: 10.18632/oncotarget.10357.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.