Molecule Information
General Information of the Molecule (ID: Mol01456)
| Name |
hsa-mir-29c
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 29c
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR29C
|
||||
| Gene ID | |||||
| Location |
chr1:207801852-207801939[-]
|
||||
| Sequence |
AUCUCUUACACAGGCUGACCGAUUUCUCCUGGUGUUCAGAGUCUGUUUUUGUCUAGCACC
AUUUGAAAUCGGUUAUGAUGUAGGGGGA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
12 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [1] | |||
| Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | DLD-1 cells | Colon | Homo sapiens (Human) | CVCL_0248 |
| KM12C cells | Colon | Homo sapiens (Human) | CVCL_9547 | |
| DLD-1 cells | Colon | Homo sapiens (Human) | CVCL_0248 | |
| KM12C cells | Colon | Homo sapiens (Human) | CVCL_9547 | |
| Experiment for Molecule Alteration |
MiRNA microarray; qRT-PCR; mRNA immunoprecipitation | |||
| Experiment for Drug Resistance |
Cell proliferation assay; Flow cytometry | |||
| Mechanism Description | We revealed up-regulation of miR-19b in response to 5-FU and potential targets of miR-19b mediating the cell cycle under treatment with 5-FU. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [2] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
| CP70 cells | Ovary | Homo sapiens (Human) | CVCL_0135 | |
| HeyC2 cells | Ovary | Homo sapiens (Human) | CVCL_X009 | |
| In Vivo Model | NOD/SCID nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | Knockdown of miR-29a/b/c increased the ability of cells to escape cisplatin-induced cell death partly through upregulation of collagen type I alpha 1 (COL1A1) and increased the activation of extracellular signal-regulated kinase 1/2 and inactivation of glycogen synthase kinase 3 beta. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | [3] | |||
| Sensitive Disease | Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | 5-8F cells | Nasopharynx | Homo sapiens (Human) | CVCL_C528 |
| CNE2 cells | Nasopharynx | Homo sapiens (Human) | CVCL_6889 | |
| C666-1 cells | Throat | Homo sapiens (Human) | CVCL_7949 | |
| CNE1 cells | Throat | Homo sapiens (Human) | CVCL_6888 | |
| HONE1 cells | Throat | Homo sapiens (Human) | CVCL_8706 | |
| 6-10B cells | Nasopharynx | Homo sapiens (Human) | CVCL_C529 | |
| SUNE-1 cells | Nasopharynx | Homo sapiens (Human) | CVCL_6946 | |
| HNE-2 cells | Nasopharynx | Homo sapiens (Human) | CVCL_FA07 | |
| In Vivo Model | SCID-Beige nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-29c repressed expression of anti-apoptotic factors, Mcl-1 and Bcl-2 in NPC tissues and cell lines, cause the resstance to Cisplatin. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Nasopharyngeal cancer [ICD-11: 2B6B.1] | [4] | |||
| Resistant Disease | Nasopharyngeal cancer [ICD-11: 2B6B.1] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | C666-1 cells | Throat | Homo sapiens (Human) | CVCL_7949 |
| SUNE-1 cells | Nasopharynx | Homo sapiens (Human) | CVCL_6946 | |
| In Vivo Model | Balb/c athymic nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-29c was downregulated and integrin beta-1 (ITGB1) was upregulated in Taxol-resistant NPC cells compared with parental NPC cells. Further investigations using a TUNEL assay and BAX/BCL-2 ratio, found that overexpression of miR-29c and knockdown of ITGB1 can resensitize drug-resistant NPC cells to Taxol and promote apoptosis. | |||
| Disease Class: Nasopharyngeal cancer [ICD-11: 2B6B.1] | [4] | |||
| Resistant Disease | Nasopharyngeal cancer [ICD-11: 2B6B.1] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | C666-1 cells | Throat | Homo sapiens (Human) | CVCL_7949 |
| SUNE-1 cells | Nasopharynx | Homo sapiens (Human) | CVCL_6946 | |
| In Vivo Model | Balb/c athymic nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-29c was downregulated and integrin beta-1 (ITGB1) was upregulated in Taxol-resistant NPC cells compared with parental NPC cells. Further investigations using a TUNEL assay and BAX/BCL-2 ratio, found that overexpression of miR-29c and knockdown of ITGB1 can resensitize drug-resistant NPC cells to Taxol and promote apoptosis. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [5] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
MiRNA microarray; RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [6] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | MRP-1/ABCC1 | Regulation | N.A. | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
RT-PCR; qRT-PCR; Luciferase reporter assay; Western blot; Immunofluorescence staining | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | Seventeen of miRNAs were differentially expressed in MCF-7/VP cells and their parent cells. The majority of these miRNAs exhibited increased expression levels, while miR-326, miR-429, miR-187, miR-7, and miR-92-2 showed decreased expression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [7] | |||
| Sensitive Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Sensitive Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell colony | Inhibition | hsa05200 | ||
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-29c targets USP22 and suppresses autophagy-mediated chemoresistance in a xenograft tumor model in vivo. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [8] | |||
| Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Resistant Drug | Imatinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Mitochondrial apoptosis pathway | Regulation | N.A. | |
| In Vitro Model | HL-60 cells | Peripheral blood | Homo sapiens (Human) | CVCL_0002 |
| In Vivo Model | CML patients | Homo sapiens | ||
| Experiment for Molecule Alteration |
RT-PCR; qRT-PCR; Western blot | |||
| Experiment for Drug Resistance |
Cell viability assay | |||
| Mechanism Description | The deregulation of miR-26a, miR-29c, miR-130b, miR-146a and their predicted targets C-IAP-1 and MCL-1 might be a mechanism of IM resistance since these genes are anti-apoptotic and may inhibit the BCR-ABL+ cell death increasing the leukemic cell survival. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [9] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Methotrexate | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | Overexpression of miR-29c suppressed MTX resistance and promoted cell apoptosis by downregulating MCL1 expression. | |||
| Drug Sensitive Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [10] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | Colorectal cancer cells | Colon | Homo sapiens (Human) | N.A. |
| In Vivo Model | Colorectal cancer patients | Homo sapiens | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Mechanism Description | Specifically, significantly higher miR-29c-3p levels were observed in patients whose best response was disease control (response or stable disease) (p = .0051; Figure 4B). | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [11] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | CDk6 knockdown attenuated the effects of miR-29c inhibition on paclitaxel cytotoxicity in breast cancer cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [11] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | LINC00511 knockdown enhanced paclitaxel cytotoxicity in breast cancer cells by upregulating miR-29c. | |||
| Disease Class: Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | [4] | |||
| Sensitive Disease | Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | C666-1 cells | Throat | Homo sapiens (Human) | CVCL_7949 |
| SUNE-1 cells | Nasopharynx | Homo sapiens (Human) | CVCL_6946 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | Overexpression of miR-29c and knockdown of ITGB1 can resensitize drug-resistant NPC cells to Taxol and promote apoptosis. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Malignant glioma [ICD-11: 2A00.2] | [12] | |||
| Resistant Disease | Malignant glioma [ICD-11: 2A00.2] | |||
| Resistant Drug | Temozolomide | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | DNA damage repair signaling pathway | Activation | hsa03410 | |
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| LN229 cells | Brain | Homo sapiens (Human) | CVCL_0393 | |
| U373 cells | Brain | Homo sapiens (Human) | CVCL_2219 | |
| U118 cells | Brain | Homo sapiens (Human) | CVCL_0633 | |
| NHA | Brain | Homo sapiens (Human) | N.A. | |
| Experiment for Molecule Alteration |
qRT-PCR; RIP assay; Dual luciferase reporter assay | |||
| Experiment for Drug Resistance |
MTT assay; BrdU incorporation assay | |||
| Mechanism Description | XIST can amplify the chemoresistance of glioma cell lines to TMZ through directly targetting miR29c via SP1 and MGMT. XIST expression was up-regulated by miR29c inhibition while down-regulated by ectopic miR29, and XIST directly binds to miR29c to inhibit its expression, XIST and miR29c neatively regulates each other. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioma [ICD-11: 2A00.1] | [12] | |||
| Sensitive Disease | Glioma [ICD-11: 2A00.1] | |||
| Sensitive Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | DNA mismatch repair pathway | Regulation | N.A. | |
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| LN229 cells | Brain | Homo sapiens (Human) | CVCL_0393 | |
| U373 cells | Brain | Homo sapiens (Human) | CVCL_2219 | |
| U118 cells | Brain | Homo sapiens (Human) | CVCL_0633 | |
| NHA | Brain | Homo sapiens (Human) | N.A. | |
| Experiment for Molecule Alteration |
qRT-PCR; RIP assay; Dual luciferase reporter assay | |||
| Experiment for Drug Resistance |
MTT assay; BrdU incorporation assay | |||
| Mechanism Description | XIST can amplify the chemoresistance of glioma cell lines to TMZ through directly targetting miR29c via SP1 and MGMT. XIST/miR29c axis regulated glioma cell chemoresistance to TMZ through RNA mismatch repair pathway. XIST expression was up-regulated by miR29c inhibition while down-regulated by ectopic miR29, and XIST directly binds to miR29c to inhibit its expression, XIST and miR29c neatively regulates each other. | |||
| Disease Class: Glioma [ICD-11: 2A00.1] | [13] | |||
| Sensitive Disease | Glioma [ICD-11: 2A00.1] | |||
| Sensitive Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| DNA mismatch repair pathway | Regulation | N.A. | ||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | Ectopic expression of miR-29c increased TMZ sensitivity by inhibiting cell growth and promoting apoptosis in U251/TR cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [5] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Verapamil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
MiRNA microarray; RT-PCR; Western blot | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
