Molecule Information

General Information of the Molecule (ID: Mol01450)

• Name: hsa-mir-320a ,Homo sapiens
• Synonyms: microRNA 320a
• Molecule Type: Precursor miRNA
• Gene Name: MIR320A
• Gene ID: 407037
• Location: chr8:22244962-22245043[-]
• Sequence:
  CUCCCCUCCGCCUUCUCUUCCCGGUUCUUCCCGGAGUCGGGAAAAGCUGGGUUGAGAGGG
  CGAAAAAGGAUG
• Ensembl ID: ENSG00000208037
• HGNC ID: HGNC:31632
• Precursor Accession: MI0000542

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 10 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [1]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: HCT-8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vivo Model: Breast cancer patient tumour model; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR; Western Blot; Chromatin Immunoprecipitation Assay; ImmunohistochemicalAnalysis
• Experiment for Drug Resistance: Apoptosis Assay; Cell Viability Assay
• Mechanism Description: In conclusion, miR-320a is a mediator of chemoresistance by targeting TRPC5 and NFATC3. Expression of miR-320a is regulated by methylation of its promoter and that of ETS-1.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.0] [2]

• Resistant Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: OE19 cells; Esophagus; Homo sapiens (Human); CVCL_1622
• In Vitro Model: kYSE410 cells; Esophagus; Homo sapiens (Human); CVCL_1352
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Chemotherapy resistant sublines were found to have specific miRNA signatures, and these miRNA signatures were different for the cisplatin vs 5-FU resistant cells from the same tumor cell line, and also for EAC vs ESCC cells with resistance to the same specific chemotherapy agent. Amongst others, miR-27b-3p, miR-193b-3p, miR-192-5p, miR-378 a-3p, miR-125a-5p and miR-18a-3p were dysregulated, consistent with negative posttranscriptional control of KRAS, TYMS, ABCC3, CBL-B and ERBB2 expression via these miRNAs.

Doxorubicin

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [ICD-11: 2B51.0] [3]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MG-63 cells; Bone; Homo sapiens (Human); CVCL_0426
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: HOS cells; Bone; Homo sapiens (Human); CVCL_0312
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vitro Model: HFOB cells; Bone; Homo sapiens (Human); CVCL_3708
• In Vivo Model: Osteosarcoma patients; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR; Dual luciferase reporter assay; RNA immunoprecipitation (RIP) assay; Western blot
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Moreover, dual luciferase reporter and RNA immunoprecipitation assays revealed that miR-320a targeted to SNHG12. Besides, knockdown of SNHG12 contributed to the upregulation of miR-320a and improved the sensitivity of doxorubicin. Additionally, miR-320a inhibited the expression of Myeloid cell leukemia 1 (MCL1). Finally, the results indicated that SNHG12 mediated doxorubicin resistance of osteosarcoma via miR-320a/MCL1 axis.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MRP-1/ABCC1; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR; Luciferase reporter assay; Western blot; Immunofluorescence staining
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Seventeen of miRNAs were differentially expressed in MCF-7/VP cells and their parent cells. The majority of these miRNAs exhibited increased expression levels, while miR-326, miR-429, miR-187, miR-7, and miR-92-2 showed decreased expression.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastrointestinal stromal tumor [ICD-11: 2B5B.1] [5]

• Resistant Disease: Gastrointestinal stromal tumor [ICD-11: 2B5B.1]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: GIST patients and GIST patients who developed imatinib resistance; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR
• Mechanism Description: Compared with the primary GISTs, the expression levels of five genes (hsa-miR-15a, hsa-miR-16, hsa-miR-195, hsa-miR-335, and hsa-miR-151-5p) were upregulated and the levels of eight genes (hsa-miR-1280, hsa-miR-140-5p, hsa-miR-320a, hsa-miR-135b, hsa-miR-664*, hsa-miR-483-5p, hsa-miR-140-3p, and hsa-miR-574-3p) were downregulated in imatinib-resistant GISTs. Data suggested that the downregulation of miR-320a in GISTs could be responsible for the tumor acquiring drug-resistant potential, resulting in imatinib resistance.

Methotrexate

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [6]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Methotrexate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• Experiment for Molecule Alteration: qRT-PCR; Microarrays assay; Gene expression levels analysis
• Experiment for Drug Resistance: Apoptosis assay; Cell viability assay
• Mechanism Description: MiRNA microarrays were performed with the aim to find differentially expressed miRNAs in HT29 resistant cells compared to their sensitive counterparts. 10 miRNAs fulfilled these criteria.

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [2]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR-320-FOXM1; Regulation; N.A.
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• Experiment for Molecule Alteration: qRT-PCR; Western blot; Luciferase assays
• Experiment for Drug Resistance: MTT assay; Colony formation assays; Apoptosis and cell cycle analysis; Migration and invasion assay
• Mechanism Description: miR-320 enhances the sensitivity of human colon cancer cells to chemoradiotherapy in vitro by targeting FOXM1

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [7]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: RT-PCR, miRNA microarray
• Mechanism Description: Sixteen up-regulated miRNAs and twenty-three down-regulated miRNAs were revealed in pacilitaxel-resistant ST30 cells. The up-regulated miRNAs (miR-320a, 22 and 129-5p) and down-regulated miRNAs (miR-9, 155 and 640) were confirmed in paclitaxel-resistant FFPE tumor samples, compared with paclitaxel-sensitive samples.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [8]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• Experiment for Molecule Alteration: Real-time PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: To investigate the role of miR-320a in the development of resistance to tamoxifen, we established tamoxifen-resistant (TamR) models by continually exposing MCF-7 or T47D breast cancer cells to tamoxifen, and identified microRNA(miRNA)-320a as a down-regulated miRNA in tamoxifen resistant cells. Re-expression of miR-320a was sufficient to sensitize TamR cells to tamoxifen by targeting cAMP-regulated phosphoprotein (ARPP-19) and estrogen-related receptor gamma (ERR) as well as their downstream effectors, c-Myc and Cyclin D1. Furthermore, progesterone (P4) promoted the expression of miR-320a by repressing c-Myc expression, while estrogen (E2) exerted the opposite effect.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [9]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Clinical Trial Drug(s) 1 drug(s) in total

PLX4720

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Papillary thyroid carcinoma [ICD-11: 2D10.1] [10]

• Resistant Disease: Papillary thyroid carcinoma [ICD-11: 2D10.1]
• Resistant Drug: PLX4720
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: Immunoblot analysis; qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: This gene is up-regulated in PLX4720-resistance cells

References

• Ref 1: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 2: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
• Ref 3: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
• Ref 4: Involvement of miR-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem Pharmacol. 2010 Mar 15;79(6):817-24. doi: 10.1016/j.bcp.2009.10.017. Epub 2009 Oct 31.
• Ref 5: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 6: Underexpression of miR-224 in methotrexate resistant human colon cancer cells. Biochem Pharmacol. 2011 Dec 1;82(11):1572-82. doi: 10.1016/j.bcp.2011.08.009. Epub 2011 Aug 16.
• Ref 7: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 8: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 9: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 10: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.