Molecule Information

General Information of the Molecule (ID: Mol01449)

• Name: hsa-mir-320 ,Homo sapiens
• Synonyms: microRNA 320a
• Molecule Type: Precursor miRNA
• Gene Name: MIR320A
• Gene ID: 407037
• Location: chr8:22244962-22245043[-]
• Sequence:
  CUCCCCUCCGCCUUCUCUUCCCGGUUCUUCCCGGAGUCGGGAAAAGCUGGGUUGAGAGGG
  CGAAAAAGGAUG
• Ensembl ID: ENSG00000208037
• HGNC ID: HGNC:31632
• Precursor Accession: MI0000542

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 6 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell growth; Inhibition; hsa05200
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Overexpression of miR320a inhibited tumor growth in vitro and in vivo and increased the sensitivity of GC cells to cisplatin by targeting ADAM10.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [2]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• In Vitro Model: HOS cells; Bone; Homo sapiens (Human); CVCL_0312
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: The up-regulation of MCL1 reversed the sensitivity of doxorubicin induced by miR-320a mimics and knockdown of SNHG12.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [3]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: PANC-1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: PATU8988 cells; Pancreas; Homo sapiens (Human); CVCL_1846
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; Wound Healing assay; Matrigel transmembrane invasion assay
• Mechanism Description: miR-320a was up-regulated in 5-FU resistant pancreatic cancer cells and that miR-320a could promote pancreatic cancer cell proliferation, migration and invasion then contributed to the increased 5-FU resistance. Researchers think miR-320a could suppress cell apoptosis by inhibiting PDCD4 and further contribute to drug-resistance, which will be studied in future.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [4]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: SUDHL-4 cells; Peritoneal effusion; Homo sapiens (Human); CVCL_0539
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: DGCR5 and miR320a regulate each other in a reciprocal manner and that DGCR5 reverses the inhibition of PDCD4 by miR320a, which is involved in the regulation of the PDAC cell phenotype and response to 5-FU. miR320a is involved in 5-FU resistance modulated by DGCR5. DGCR5 reversed the inhibition of the miR320a target gene PDCD4, which in turn inhibited the proliferation, migration and 5-FU resistance of PDAC cells.

Disease Class: Colon cancer [5]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Inhibition; hsa04310
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-320 enhances the sensitivity of human colon cancer cells to chemoradiotherapy in vitro by targeting FOXM1.

Disease Class: Breast cancer [6]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: TRPC5 signaling pathway; Regulation; hsa05206
• In Vitro Model: MCF-7/ADM cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The overexpression of miR-320a, which downregulated TRPC5 and NFATC3, colud inreduce chemoresistance.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastrointestinal stromal tumor [7]

• Resistant Disease: Gastrointestinal stromal tumor [ICD-11: 2B5B.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-320a was downregulated in imatinib-resistant GISTs and low expression of miR-320a was found to be associated with short TTR. This confirmed that miR-320a was involved in the process of imatinib resistance.

Oxaliplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [5]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Inhibition; hsa04310
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: HT-29 cells; Colon; Homo sapiens (Human); CVCL_0320
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-320 enhances the sensitivity of human colon cancer cells to chemoradiotherapy in vitro by targeting FOXM1.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [6]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: TRPC5 signaling pathway; Regulation; hsa05206
• In Vitro Model: MCF-7/ADM cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The overexpression of miR-320a, which downregulated TRPC5 and NFATC3, colud inreduce chemoresistance.

References

• Ref 1: miR-320a modulates cell growth and chemosensitivity via regulating ADAM10 in gastric cancer. Mol Med Rep. 2017 Dec;16(6):9664-9670. doi: 10.3892/mmr.2017.7819. Epub 2017 Oct 19.
• Ref 2: Long noncoding RNA SNHG12 mediates doxorubicin resistance of osteosarcoma via miR-320a/MCL1 axis. Biomed Pharmacother. 2018 Oct;106:850-857. doi: 10.1016/j.biopha.2018.07.003. Epub 2018 Jul 11.
• Ref 3: MicroRNA-320a promotes 5-FU resistance in human pancreatic cancer cells. Sci Rep. 2016 Jun 9;6:27641. doi: 10.1038/srep27641.
• Ref 4: Reciprocal regulation of DGCR5 and miR-320a affects the cellular malignant phenotype and 5-FU response in pancreatic ductal adenocarcinoma. Oncotarget. 2017 Jun 6;8(53):90868-90878. doi: 10.18632/oncotarget.18377. eCollection 2017 Oct 31.
• Ref 5: miR-320 enhances the sensitivity of human colon cancer cells to chemoradiotherapy in vitro by targeting FOXM1. Biochem Biophys Res Commun. 2015 Feb 6;457(2):125-32. doi: 10.1016/j.bbrc.2014.11.039. Epub 2014 Nov 21.
• Ref 6: A methylation-based regulatory network for microRNA 320a in chemoresistant breast cancer. Mol Pharmacol. 2014 Nov;86(5):536-47. doi: 10.1124/mol.114.092759. Epub 2014 Aug 26.
• Ref 7: MiR-320a downregulation is associated with imatinib resistance in gastrointestinal stromal tumors. Acta Biochim Biophys Sin (Shanghai). 2014 Jan;46(1):72-5. doi: 10.1093/abbs/gmt118. Epub 2013 Nov 10.