Molecule Information
General Information of the Molecule (ID: Mol01449)
| Name |
hsa-mir-320
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 320a
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR320A
|
||||
| Gene ID | |||||
| Location |
chr8:22244962-22245043[-]
|
||||
| Sequence |
CUCCCCUCCGCCUUCUCUUCCCGGUUCUUCCCGGAGUCGGGAAAAGCUGGGUUGAGAGGG
CGAAAAAGGAUG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell growth | Inhibition | hsa05200 | |
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | Overexpression of miR320a inhibited tumor growth in vitro and in vivo and increased the sensitivity of GC cells to cisplatin by targeting ADAM10. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [2] | |||
| Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell viability | Activation | hsa05200 | ||
| In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
| SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
| U2OS cells | Bone | Homo sapiens (Human) | CVCL_0042 | |
| HOS cells | Bone | Homo sapiens (Human) | CVCL_0312 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | The up-regulation of MCL1 reversed the sensitivity of doxorubicin induced by miR-320a mimics and knockdown of SNHG12. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [3] | |||
| Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | PANC-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0480 |
| PATU8988 cells | Pancreas | Homo sapiens (Human) | CVCL_1846 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Wound Healing assay; Matrigel transmembrane invasion assay | |||
| Mechanism Description | miR-320a was up-regulated in 5-FU resistant pancreatic cancer cells and that miR-320a could promote pancreatic cancer cell proliferation, migration and invasion then contributed to the increased 5-FU resistance. Researchers think miR-320a could suppress cell apoptosis by inhibiting PDCD4 and further contribute to drug-resistance, which will be studied in future. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | [4] | |||
| Sensitive Disease | Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | SUDHL-4 cells | Peritoneal effusion | Homo sapiens (Human) | CVCL_0539 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | DGCR5 and miR320a regulate each other in a reciprocal manner and that DGCR5 reverses the inhibition of PDCD4 by miR320a, which is involved in the regulation of the PDAC cell phenotype and response to 5-FU. miR320a is involved in 5-FU resistance modulated by DGCR5. DGCR5 reversed the inhibition of the miR320a target gene PDCD4, which in turn inhibited the proliferation, migration and 5-FU resistance of PDAC cells. | |||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [5] | |||
| Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| Wnt/Beta-catenin signaling pathway | Inhibition | hsa04310 | ||
| In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-320 enhances the sensitivity of human colon cancer cells to chemoradiotherapy in vitro by targeting FOXM1. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [6] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| TRPC5 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | MCF-7/ADM cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The overexpression of miR-320a, which downregulated TRPC5 and NFATC3, colud inreduce chemoresistance. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastrointestinal stromal tumor [ICD-11: 2B5B.0] | [7] | |||
| Resistant Disease | Gastrointestinal stromal tumor [ICD-11: 2B5B.0] | |||
| Resistant Drug | Imatinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-320a was downregulated in imatinib-resistant GISTs and low expression of miR-320a was found to be associated with short TTR. This confirmed that miR-320a was involved in the process of imatinib resistance. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [5] | |||
| Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Sensitive Drug | Oxaliplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| Wnt/Beta-catenin signaling pathway | Inhibition | hsa04310 | ||
| In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| HT-29 cells | Colon | Homo sapiens (Human) | CVCL_0320 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-320 enhances the sensitivity of human colon cancer cells to chemoradiotherapy in vitro by targeting FOXM1. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [6] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| TRPC5 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | MCF-7/ADM cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The overexpression of miR-320a, which downregulated TRPC5 and NFATC3, colud inreduce chemoresistance. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
