Molecule Information

General Information of the Molecule (ID: Mol01443)

• Name: hsa-mir-150 ,Homo sapiens
• Synonyms: microRNA 150
• Molecule Type: Precursor miRNA
• Gene Name: MIR150
• Gene ID: 406942
• Location: chr19:49500785-49500868[-]
• Sequence:
  CUCCCCAUGGCCCUGUCUCCCAACCCUUGUACCAGUGCUGGGCUCAGACCCUGGUACAGG
  CCUGGGGGACAGGGACCUGGGGAC
• Ensembl ID: ENSG00000207782
• HGNC ID: HGNC:31537
• Precursor Accession: MI0000479

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: WST assay
• Mechanism Description: Higher expression of miR-146a and miR-150 in omental lesions may lead to more aggressive, chemoresistant disease.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [ICD-11: 2C94.0] [2]

• Sensitive Disease: Bladder cancer [ICD-11: 2C94.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: 5637 cells; Bladder; Homo sapiens (Human); CVCL_0126
• In Vitro Model: T24 cells; Bladder; Homo sapiens (Human); CVCL_0554
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: miR-150 functions as a tumor promoter in reducing chemosensitivity and promoting invasiveness of MIBC cells via downretulating PDCD4.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [3]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.02]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SH-SY5Y cells; Abdomen; Homo sapiens (Human); CVCL_0019
• In Vitro Model: Kelly cells; Adrenal; Homo sapiens (Human); CVCL_2092
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Luminescence-based cell viability analysis
• Mechanism Description: However, it certainly is of interest to highlight the possible involvement of such miRNAs in affecting the most common means of chemoresistance-inducing cellular pathways within such cell lines. A typical example would be the effect of such miRNAs on the ABC transporter system and its member genes that regulate drug efflux properties of the cell.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qRT-PCR, Reverse Transcription and Running ABC Transporter TLDA
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Using miRNA microfluidic arrays from ABI, we determined the microRNA profile for MCF7VP cells compared to drug sensitive cells. Multiple miRNAs showed differential expression among the cell lines including hsa-miR-382, hsa-miR-23b and hsa-miR-885-5p, which were up-regulated (>2-fold increase) in MCF7VP cells and hsa-mir-218, hsa-miR-758 and hsa-miR-548d-5p, which were down-regulated (>2-fold decrease) in MCF7VP cells, suggesting that etoposide resistant MCF7 cells have a miRNA profile that is distinct from the MCF7 drug sensitive cell line.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [5]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: MYC/miR-150/MYB/miR-155/PU.1; Regulation; N.A.
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vitro Model: Meg-01 cells; Blood; Homo sapiens (Human); CVCL_0425
• In Vitro Model: KCL-22 cells; Bone marrow; Homo sapiens (Human); CVCL_2091
• In Vitro Model: HL-60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• In Vitro Model: KG-1 cells; Bone marrow; Homo sapiens (Human); CVCL_0374
• Experiment for Molecule Alteration: RT-PCR; Western blot
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: Previously, microRNA expression profiling showed deregulated expression of miR-150 and miR-155 in CML

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [6]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Advanced renal cell carcinoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: Blood samples from 38 patients and 287 miRNAs were evaluated. Twenty-eight miRNAs of the 287 were related to poor response and 23 of the 287 were related to prolonged response to sunitinib treatment. Predictive models identified populations with differences in the established end points.

References

• Ref 1: Identification of ovarian cancer metastatic miRNAs. PLoS One. 2013;8(3):e58226. doi: 10.1371/journal.pone.0058226. Epub 2013 Mar 12.
• Ref 2: miR-150 modulates cisplatin chemosensitivity and invasiveness of muscle-invasive bladder cancer cells via targeting PDCD4 in vitro. Med Sci Monit. 2014 Oct 7;20:1850-7. doi: 10.12659/MSM.891340.
• Ref 3: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 4: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 5: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
• Ref 6: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.