Molecule Information
General Information of the Molecule (ID: Mol01443)
| Name |
hsa-mir-150
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 150
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR150
|
||||
| Gene ID | |||||
| Location |
chr19:49500785-49500868[-]
|
||||
| Sequence |
CUCCCCAUGGCCCUGUCUCCCAACCCUUGUACCAGUGCUGGGCUCAGACCCUGGUACAGG
CCUGGGGGACAGGGACCUGGGGAC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [1] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| IGROV1 cells | Ovary | Homo sapiens (Human) | CVCL_1304 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
WST assay | |||
| Mechanism Description | Higher expression of miR-146a and miR-150 in omental lesions may lead to more aggressive, chemoresistant disease. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [2] | |||
| Sensitive Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
| T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | miR-150 functions as a tumor promoter in reducing chemosensitivity and promoting invasiveness of MIBC cells via downretulating PDCD4. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
