Molecule Information
General Information of the Molecule (ID: Mol01442)
| Name |
hsa-mir-149
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 149
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR149
|
||||
| Gene ID | |||||
| Location |
chr2:240456001-240456089[+]
|
||||
| Sequence |
GCCGGCGCCCGAGCUCUGGCUCCGUGUCUUCACUCCCGUGCUUGUCCGAGGAGGGAGGGA
GGGACGGGGGCUGUGCUGGGGCAGCUGGA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
8 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell viability | Inhibition | hsa05200 | |
| In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-149 enhances SGC7901/DDP cell sensitivity to cisplatin by downregulating FoxM1 expression. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [2] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| Experiment for Molecule Alteration |
qRT-PCR; Western blot; Dual luciferase assay | |||
| Experiment for Drug Resistance |
Cell viability assay | |||
| Mechanism Description | Increased miR-34a expression may therefore be able to inhibit docetaxel activity by arresting cells in G1 phase. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| HS signaling pathway | Inhibition | hsa00534 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR; RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-149 modulated chemoresistance through targeting the expression of GlcNAc N-deacetylase/N-sulfotransferase-1 (NDST1). With downregulated miR-149, NDST1 expression was increased in chemoresistant MCF-7/ADM cells versus control MCF-7 wild-type cells. The increased NDST1 then activated a heparan sulfate-related pathway involving activation of heparanase. Finally, expression of miR-149 and NDST1 was confirmed in clinical chemoresistant samples of breast cancers receiving anthracycline/taxane-based chemotherapies. The high expression of NDST1 was also an unfavorable predictor for distant relapse-free survival in Her2 and basal breast cancers. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| HS signaling pathway | Inhibition | hsa00534 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR; RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-149 modulated chemoresistance through targeting the expression of GlcNAc N-deacetylase/N-sulfotransferase-1 (NDST1). With downregulated miR-149, NDST1 expression was increased in chemoresistant MCF-7/ADM cells versus control MCF-7 wild-type cells. The increased NDST1 then activated a heparan sulfate-related pathway involving activation of heparanase. Finally, expression of miR-149 and NDST1 was confirmed in clinical chemoresistant samples of breast cancers receiving anthracycline/taxane-based chemotherapies. The high expression of NDST1 was also an unfavorable predictor for distant relapse-free survival in Her2 and basal breast cancers. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [4] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | AKT/mTOR signaling pathway | Regulation | N.A. | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| In Vitro Model | HCT-8 cells | Colon | Homo sapiens (Human) | CVCL_2478 |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Reduced miR-149 is a critical factor in the mechanisms by which CRC cells resist the cytotoxicity of 5-FU. Also, re-expression of miR-149 could increase the 5-FU sensitivity of CRC cells via enhancing 5-FU-inducing apoptosis by targeting FOXM1. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [6] | |||
| Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Resistant Drug | Methotrexate | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| Experiment for Molecule Alteration |
qRT-PCR; Microarrays assay; Gene expression levels analysis | |||
| Experiment for Drug Resistance |
Apoptosis assay; Cell viability assay | |||
| Mechanism Description | MiRNA microarrays were performed with the aim to find differentially expressed miRNAs in HT29 resistant cells compared to their sensitive counterparts. 10 miRNAs fulfilled these criteria. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] | [7] | |||
| Resistant Disease | Malignant pleural mesothelioma [ICD-11: 2C26.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H69 cells | Lung | Homo sapiens (Human) | CVCL_8121 | |
| H69AR cells | Lung | Homo sapiens (Human) | CVCL_3513 | |
| MSTO-211H cells | Lung | Homo sapiens (Human) | CVCL_1430 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | micro-RNA149 confers taxane resistance to malignant mesothelioma cells via upregulation of P-glycoprotein expression. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [8] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell invasion | Activation | hsa05200 | ||
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| TLR/MyD88 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Transwell assay | |||
| Mechanism Description | In the present study, flow cytometric assays were used to detect the apoptosis of A2780 cells after down-regulation of miRNA-149. We found that down-regulation of miRNA-149 decreased the apoptosis induced by paclitaxel when compared to the control group. Furthermore, we showed that down-regulation of miRNA-149 in A2780 cells (+) the expression of the anti-apoptotic protein Bcl-2 and inhibited the expression of the pro-apoptotic protein bax, which may have led to paclitaxel resistance. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| HS signaling pathway | Inhibition | hsa00534 | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR; RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-149 modulated chemoresistance through targeting the expression of GlcNAc N-deacetylase/N-sulfotransferase-1 (NDST1). With downregulated miR-149, NDST1 expression was increased in chemoresistant MCF-7/ADM cells versus control MCF-7 wild-type cells. The increased NDST1 then activated a heparan sulfate-related pathway involving activation of heparanase. Finally, expression of miR-149 and NDST1 was confirmed in clinical chemoresistant samples of breast cancers receiving anthracycline/taxane-based chemotherapies. The high expression of NDST1 was also an unfavorable predictor for distant relapse-free survival in Her2 and basal breast cancers. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [9] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Tamoxifen | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| LCC2 cells | Breast | Homo sapiens (Human) | CVCL_DP51 | |
| LCC9 cells | Breast | Homo sapiens (Human) | CVCL_DP52 | |
| Experiment for Molecule Alteration |
Microarray analyses; qPCR; RT-PCR; Western blot | |||
| Mechanism Description | Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [10] | |||
| Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Sensitive Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | U251 cells | Brain | Homo sapiens (Human) | CVCL_0021 |
| U87 cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Expression of Rap1B is negatively regulated by miR-128 and miR-149. TMZ inhibits Rap1B expression by upregulating miR-128 and miR-149. miR-128 and miR-149 suppress cell proliferation and invasion, and alter cytoskeletal remodeling by affecting Rap1B-associated small GTPase. miR-128 and miR-149 increase the chemosensitivity of TMZ in glioblastoma cells. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
