Molecule Information

General Information of the Molecule (ID: Mol01442)

• Name: hsa-mir-149 ,Homo sapiens
• Synonyms: microRNA 149
• Molecule Type: Precursor miRNA
• Gene Name: MIR149
• Gene ID: 406941
• Location: chr2:240456001-240456089[+]
• Sequence:
  GCCGGCGCCCGAGCUCUGGCUCCGUGUCUUCACUCCCGUGCUUGUCCGAGGAGGGAGGGA
  GGGACGGGGGCUGUGCUGGGGCAGCUGGA
• Ensembl ID: ENSG00000207611
• HGNC ID: HGNC:31536
• Precursor Accession: MI0000478

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-149 enhances SGC7901/DDP cell sensitivity to cisplatin by downregulating FoxM1 expression.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: HS signaling pathway; Inhibition; hsa00534
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-149 modulated chemoresistance through targeting the expression of GlcNAc N-deacetylase/N-sulfotransferase-1 (NDST1). With downregulated miR-149, NDST1 expression was increased in chemoresistant MCF-7/ADM cells versus control MCF-7 wild-type cells. The increased NDST1 then activated a heparan sulfate-related pathway involving activation of heparanase. Finally, expression of miR-149 and NDST1 was confirmed in clinical chemoresistant samples of breast cancers receiving anthracycline/taxane-based chemotherapies. The high expression of NDST1 was also an unfavorable predictor for distant relapse-free survival in Her2 and basal breast cancers.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: HS signaling pathway; Inhibition; hsa00534
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-149 modulated chemoresistance through targeting the expression of GlcNAc N-deacetylase/N-sulfotransferase-1 (NDST1). With downregulated miR-149, NDST1 expression was increased in chemoresistant MCF-7/ADM cells versus control MCF-7 wild-type cells. The increased NDST1 then activated a heparan sulfate-related pathway involving activation of heparanase. Finally, expression of miR-149 and NDST1 was confirmed in clinical chemoresistant samples of breast cancers receiving anthracycline/taxane-based chemotherapies. The high expression of NDST1 was also an unfavorable predictor for distant relapse-free survival in Her2 and basal breast cancers.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [3]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT/mTOR signaling pathway; Regulation; hsa04150
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: HCT-8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Reduced miR-149 is a critical factor in the mechanisms by which CRC cells resist the cytotoxicity of 5-FU. Also, re-expression of miR-149 could increase the 5-FU sensitivity of CRC cells via enhancing 5-FU-inducing apoptosis by targeting FOXM1.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant pleural mesothelioma [4]

• Resistant Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H69 cells; Lung; Homo sapiens (Human); CVCL_8121
• In Vitro Model: H69AR cells; Lung; Homo sapiens (Human); CVCL_3513
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: micro-RNA149 confers taxane resistance to malignant mesothelioma cells via upregulation of P-glycoprotein expression.

Disease Class: Ovarian cancer [5]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: TLR/MyD88 signaling pathway; Regulation; hsa04620
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Transwell assay
• Mechanism Description: In the present study, flow cytometric assays were used to detect the apoptosis of A2780 cells after down-regulation of miRNA-149. We found that down-regulation of miRNA-149 decreased the apoptosis induced by paclitaxel when compared to the control group. Furthermore, we showed that down-regulation of miRNA-149 in A2780 cells (+) the expression of the anti-apoptotic protein Bcl-2 and inhibited the expression of the pro-apoptotic protein bax, which may have led to paclitaxel resistance.

Disease Class: Breast cancer [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: HS signaling pathway; Inhibition; hsa00534
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-149 modulated chemoresistance through targeting the expression of GlcNAc N-deacetylase/N-sulfotransferase-1 (NDST1). With downregulated miR-149, NDST1 expression was increased in chemoresistant MCF-7/ADM cells versus control MCF-7 wild-type cells. The increased NDST1 then activated a heparan sulfate-related pathway involving activation of heparanase. Finally, expression of miR-149 and NDST1 was confirmed in clinical chemoresistant samples of breast cancers receiving anthracycline/taxane-based chemotherapies. The high expression of NDST1 was also an unfavorable predictor for distant relapse-free survival in Her2 and basal breast cancers.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [6]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Expression of Rap1B is negatively regulated by miR-128 and miR-149. TMZ inhibits Rap1B expression by upregulating miR-128 and miR-149. miR-128 and miR-149 suppress cell proliferation and invasion, and alter cytoskeletal remodeling by affecting Rap1B-associated small GTPase. miR-128 and miR-149 increase the chemosensitivity of TMZ in glioblastoma cells.

References

• Ref 1: miR-149 reverses cisplatin resistance of gastric cancer SGC7901/DDP cells by targeting FoxM1. Pharmazie. 2016 Nov 2;71(11):640-643. doi: 10.1691/ph.2016.6696.
• Ref 2: Methylation-regulated miR-149 modulates chemoresistance by targeting GlcNAc N-deacetylase/N-sulfotransferase-1 in human breast cancer. FEBS J. 2014 Oct;281(20):4718-30. doi: 10.1111/febs.13012. Epub 2014 Sep 30.
• Ref 3: MicroRNA-149 Increases the Sensitivity of Colorectal Cancer Cells to 5-Fluorouracil by Targeting Forkhead Box Transcription Factor FOXM1. Cell Physiol Biochem. 2016;39(2):617-29. doi: 10.1159/000445653. Epub 2016 Jul 15.
• Ref 4: Micro-RNA149 confers taxane resistance to malignant mesothelioma cells via regulation of P-glycoprotein expression. Cancer Biol Ther. 2018 Mar 4;19(3):181-187. doi: 10.1080/15384047.2017.1415677. Epub 2018 Jan 15.
• Ref 5: MiRNA-149 modulates chemosensitivity of ovarian cancer A2780 cells to paclitaxel by targeting MyD88. J Ovarian Res. 2015 Jul 30;8:48. doi: 10.1186/s13048-015-0178-7.
• Ref 6: miR-128 and miR-149 enhance the chemosensitivity of temozolomide by Rap1B-mediated cytoskeletal remodeling in glioblastoma. Oncol Rep. 2014 Sep;32(3):957-64. doi: 10.3892/or.2014.3318. Epub 2014 Jul 10.