Molecule Information

General Information of the Molecule (ID: Mol01442)

• Name: hsa-mir-149 ,Homo sapiens
• Synonyms: microRNA 149
• Molecule Type: Precursor miRNA
• Gene Name: MIR149
• Gene ID: 406941
• Location: chr2:240456001-240456089[+]
• Sequence:
  GCCGGCGCCCGAGCUCUGGCUCCGUGUCUUCACUCCCGUGCUUGUCCGAGGAGGGAGGGA
  GGGACGGGGGCUGUGCUGGGGCAGCUGGA
• Ensembl ID: ENSG00000207611
• HGNC ID: HGNC:31536
• Precursor Accession: MI0000478

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 8 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [1]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-149 enhances SGC7901/DDP cell sensitivity to cisplatin by downregulating FoxM1 expression.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: qRT-PCR; Western blot; Dual luciferase assay
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Increased miR-34a expression may therefore be able to inhibit docetaxel activity by arresting cells in G1 phase.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: HS signaling pathway; Inhibition; hsa00534
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-149 modulated chemoresistance through targeting the expression of GlcNAc N-deacetylase/N-sulfotransferase-1 (NDST1). With downregulated miR-149, NDST1 expression was increased in chemoresistant MCF-7/ADM cells versus control MCF-7 wild-type cells. The increased NDST1 then activated a heparan sulfate-related pathway involving activation of heparanase. Finally, expression of miR-149 and NDST1 was confirmed in clinical chemoresistant samples of breast cancers receiving anthracycline/taxane-based chemotherapies. The high expression of NDST1 was also an unfavorable predictor for distant relapse-free survival in Her2 and basal breast cancers.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: HS signaling pathway; Inhibition; hsa00534
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-149 modulated chemoresistance through targeting the expression of GlcNAc N-deacetylase/N-sulfotransferase-1 (NDST1). With downregulated miR-149, NDST1 expression was increased in chemoresistant MCF-7/ADM cells versus control MCF-7 wild-type cells. The increased NDST1 then activated a heparan sulfate-related pathway involving activation of heparanase. Finally, expression of miR-149 and NDST1 was confirmed in clinical chemoresistant samples of breast cancers receiving anthracycline/taxane-based chemotherapies. The high expression of NDST1 was also an unfavorable predictor for distant relapse-free survival in Her2 and basal breast cancers.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [4]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: AKT/mTOR signaling pathway; Regulation; N.A.
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: HCT-8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Reduced miR-149 is a critical factor in the mechanisms by which CRC cells resist the cytotoxicity of 5-FU. Also, re-expression of miR-149 could increase the 5-FU sensitivity of CRC cells via enhancing 5-FU-inducing apoptosis by targeting FOXM1.

Methotrexate

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [6]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Methotrexate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• Experiment for Molecule Alteration: qRT-PCR; Microarrays assay; Gene expression levels analysis
• Experiment for Drug Resistance: Apoptosis assay; Cell viability assay
• Mechanism Description: MiRNA microarrays were performed with the aim to find differentially expressed miRNAs in HT29 resistant cells compared to their sensitive counterparts. 10 miRNAs fulfilled these criteria.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant pleural mesothelioma [ICD-11: 2C26.0] [7]

• Resistant Disease: Malignant pleural mesothelioma [ICD-11: 2C26.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H69 cells; Lung; Homo sapiens (Human); CVCL_8121
• In Vitro Model: H69AR cells; Lung; Homo sapiens (Human); CVCL_3513
• In Vitro Model: MSTO-211H cells; Lung; Homo sapiens (Human); CVCL_1430
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: micro-RNA149 confers taxane resistance to malignant mesothelioma cells via upregulation of P-glycoprotein expression.

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [8]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: TLR/MyD88 signaling pathway; Regulation; N.A.
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Transwell assay
• Mechanism Description: In the present study, flow cytometric assays were used to detect the apoptosis of A2780 cells after down-regulation of miRNA-149. We found that down-regulation of miRNA-149 decreased the apoptosis induced by paclitaxel when compared to the control group. Furthermore, we showed that down-regulation of miRNA-149 in A2780 cells (+) the expression of the anti-apoptotic protein Bcl-2 and inhibited the expression of the pro-apoptotic protein bax, which may have led to paclitaxel resistance.

Disease Class: Breast cancer [ICD-11: 2C60.3] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: HS signaling pathway; Inhibition; hsa00534
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-149 modulated chemoresistance through targeting the expression of GlcNAc N-deacetylase/N-sulfotransferase-1 (NDST1). With downregulated miR-149, NDST1 expression was increased in chemoresistant MCF-7/ADM cells versus control MCF-7 wild-type cells. The increased NDST1 then activated a heparan sulfate-related pathway involving activation of heparanase. Finally, expression of miR-149 and NDST1 was confirmed in clinical chemoresistant samples of breast cancers receiving anthracycline/taxane-based chemotherapies. The high expression of NDST1 was also an unfavorable predictor for distant relapse-free survival in Her2 and basal breast cancers.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [9]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [ICD-11: 2A00.02] [10]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: U251 cells; Brain; Homo sapiens (Human); CVCL_0021
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Expression of Rap1B is negatively regulated by miR-128 and miR-149. TMZ inhibits Rap1B expression by upregulating miR-128 and miR-149. miR-128 and miR-149 suppress cell proliferation and invasion, and alter cytoskeletal remodeling by affecting Rap1B-associated small GTPase. miR-128 and miR-149 increase the chemosensitivity of TMZ in glioblastoma cells.

References

• Ref 1: miR-149 reverses cisplatin resistance of gastric cancer SGC7901/DDP cells by targeting FoxM1. Pharmazie. 2016 Nov 2;71(11):640-643. doi: 10.1691/ph.2016.6696.
• Ref 2: miRNA-34a is associated with docetaxel resistance in human breast cancer cells. Breast Cancer Res Treat. 2012 Jan;131(2):445-54. doi: 10.1007/s10549-011-1424-3. Epub 2011 Mar 12.
• Ref 3: Methylation-regulated miR-149 modulates chemoresistance by targeting GlcNAc N-deacetylase/N-sulfotransferase-1 in human breast cancer. FEBS J. 2014 Oct;281(20):4718-30. doi: 10.1111/febs.13012. Epub 2014 Sep 30.
• Ref 4: MicroRNA-149 Increases the Sensitivity of Colorectal Cancer Cells to 5-Fluorouracil by Targeting Forkhead Box Transcription Factor FOXM1. Cell Physiol Biochem. 2016;39(2):617-29. doi: 10.1159/000445653. Epub 2016 Jul 15.
• Ref 5: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 6: Underexpression of miR-224 in methotrexate resistant human colon cancer cells. Biochem Pharmacol. 2011 Dec 1;82(11):1572-82. doi: 10.1016/j.bcp.2011.08.009. Epub 2011 Aug 16.
• Ref 7: Micro-RNA149 confers taxane resistance to malignant mesothelioma cells via regulation of P-glycoprotein expression. Cancer Biol Ther. 2018 Mar 4;19(3):181-187. doi: 10.1080/15384047.2017.1415677. Epub 2018 Jan 15.
• Ref 8: MiRNA-149 modulates chemosensitivity of ovarian cancer A2780 cells to paclitaxel by targeting MyD88. J Ovarian Res. 2015 Jul 30;8:48. doi: 10.1186/s13048-015-0178-7.
• Ref 9: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 10: miR-128 and miR-149 enhance the chemosensitivity of temozolomide by Rap1B-mediated cytoskeletal remodeling in glioblastoma. Oncol Rep. 2014 Sep;32(3):957-64. doi: 10.3892/or.2014.3318. Epub 2014 Jul 10.