General Information of the Molecule (ID: Mol01439)
Name
hsa-mir-134 ,Homo sapiens
Synonyms
microRNA 134
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR134
Gene ID
406924
Location
chr14:101054687-101054759[+]
Sequence
CAGGGUGUGUGACUGGUUGACCAGAGGGGCAUGCACUGUGUUCACCCUGUGGGCCACCUA
GUCACCAACCCUC
    Click to Show/Hide
Ensembl ID
ENSG00000207993
HGNC ID
HGNC:31519
Precursor Accession
MI0000474
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model Hs-578T cells Breast Homo sapiens (Human) CVCL_0332
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
Acid phosphatase assay
Mechanism Description When delivered directly by transfection the STAT5B and Hsp90 expression levels were reduced, but response to anti-Hsp90 drugs was not augmented. However, cellular growth was reduced and cisplatin-induced apoptosis was (+). Delivery via miR-134-enriched EVs also reduced STAT5B and Hsp90 expression, had no apparent effects on proliferation, but cellular migration and invasion were reduced and sensitivity to anti-Hsp90 drugs was (+).
Doxorubicin
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [2]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model H69AR cells Lung Homo sapiens (Human) CVCL_3513
Experiment for
Molecule Alteration
MiRNA microarray
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Following transfection of the H69AR cells with the mimics of miR-134, miR-379 and miR-495, respectively, we treated the cells with a series of concentrations of Cisplatin, Etoposide and Doxorubicin. The effect of the mimics on sensitivity to these three chemotherapeutic drugs was significantly increased by 2.79-5.17-fold in H69AR cells. Meanwhile, the growth inhibition by chemotherapeutic drugs in H69AR cells was 1.37-1.53-fold greater in the antagomir-treated cells than that in control cells.
Etoposide
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [2]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.0]
Sensitive Drug Etoposide
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model H69AR cells Lung Homo sapiens (Human) CVCL_3513
Experiment for
Molecule Alteration
MiRNA microarray
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Following transfection of the H69AR cells with the mimics of miR-134, miR-379 and miR-495, respectively, we treated the cells with a series of concentrations of Cisplatin, Etoposide and Doxorubicin. The effect of the mimics on sensitivity to these three chemotherapeutic drugs was significantly increased by 2.79-5.17-fold in H69AR cells. Meanwhile, the growth inhibition by chemotherapeutic drugs in H69AR cells was 1.37-1.53-fold greater in the antagomir-treated cells than that in control cells.
Gefitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [3]
Resistant Disease Lung adenocarcinoma [ICD-11: 2C25.0]
Resistant Drug Gefitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model PC3 cells Prostate Homo sapiens (Human) CVCL_0035
A549 cells Lung Homo sapiens (Human) CVCL_0023
PC9 cells Lung Homo sapiens (Human) CVCL_B260
PC-14 cells Lung Homo sapiens (Human) CVCL_1640
LC-2/ad cells Lung Homo sapiens (Human) CVCL_1373
RERF-LCkJ cells Lung Homo sapiens (Human) CVCL_1654
ABC-1 cells Lung Homo sapiens (Human) CVCL_1066
RERF-LCMS cells Lung Homo sapiens (Human) CVCL_1655
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-134/487b/655 cluster contributed to the TGF-beta1-induced EMT phenomenon and affected the resistance to gefitinib by directly targeting MAGI2, in which suppression subsequently caused loss of PTEN stability in lung cancer cells.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [4]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastrointestinal stromal tumor [ICD-11: 2B5B.1] [5]
Resistant Disease Gastrointestinal stromal tumor [ICD-11: 2B5B.1]
Resistant Drug Imatinib
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model GIST882 cells Gastric Homo sapiens (Human) CVCL_7044
GIST48 cells Gastric Homo sapiens (Human) CVCL_7041
In Vivo Model GIST patients Homo sapiens
Experiment for
Molecule Alteration
RT-qPCR; Western blot
Experiment for
Drug Resistance
Cytotoxicity assay
Mechanism Description Functionally, miR-125a-5p expression modulated imatinib sensitivity in GIST882 cells with a homozygous KIT mutation but not in GIST48 cells with double KIT mutations. Overexpression of miR-125a-5p suppressed PTPN18 expression, and silencing of PTPN18 expression increased cell viability in GIST882 cells upon imatinib treatment.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] [6]
Resistant Disease Epithelial ovarian cancer [ICD-11: 2B5D.0]
Resistant Drug Paclitaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell invasion Activation hsa05200
Cell migration Activation hsa04670
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
A2780 cells Ovary Homo sapiens (Human) CVCL_0134
COC1 cells Ovary Homo sapiens (Human) CVCL_6891
SkOV3-TR30 cells Ovary Homo sapiens (Human) CVCL_0532
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTS assay; Flow cytometry assay
Mechanism Description LINC01118 Can enhance ABCC1 expression by suppressing miR-134 expression to promote paclitaxel resistance in epithelial ovarian cancer.
References
Ref 1 miR-134 in extracellular vesicles reduces triple-negative breast cancer aggression and increases drug sensitivity. Oncotarget. 2015 Oct 20;6(32):32774-89. doi: 10.18632/oncotarget.5192.
Ref 2 Mutations in ABL kinase domain are associated with inferior progression-free survival. Leuk Lymphoma. 2010 Jun;51(6):1072-8. doi: 10.3109/10428191003729741.
Ref 3 MiR-134/487b/655 cluster regulates TGF-Beta-induced epithelial-mesenchymal transition and drug resistance to gefitinib by targeting MAGI2 in lung adenocarcinoma cells. Mol Cancer Ther. 2014 Feb;13(2):444-53. doi: 10.1158/1535-7163.MCT-13-0448. Epub 2013 Nov 20.
Ref 4 miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
Ref 5 The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
Ref 6 LINC01118 Modulates Paclitaxel Resistance of Epithelial Ovarian Cancer by Regulating miR-134/ABCC1. Med Sci Monit. 2018 Dec 6;24:8831-8839. doi: 10.12659/MSM.910932.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.