Molecule Information

General Information of the Molecule (ID: Mol01439)

• Name: hsa-mir-134 ,Homo sapiens
• Synonyms: microRNA 134
• Molecule Type: Precursor miRNA
• Gene Name: MIR134
• Gene ID: 406924
• Location: chr14:101054687-101054759[+]
• Sequence:
  CAGGGUGUGUGACUGGUUGACCAGAGGGGCAUGCACUGUGUUCACCCUGUGGGCCACCUA
  GUCACCAACCCUC
• Ensembl ID: ENSG00000207993
• HGNC ID: HGNC:31519
• Precursor Accession: MI0000474

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [1]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: Hs-578T cells; Breast; Homo sapiens (Human); CVCL_0332
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: Acid phosphatase assay
• Mechanism Description: When delivered directly by transfection the STAT5B and Hsp90 expression levels were reduced, but response to anti-Hsp90 drugs was not augmented. However, cellular growth was reduced and cisplatin-induced apoptosis was (+). Delivery via miR-134-enriched EVs also reduced STAT5B and Hsp90 expression, had no apparent effects on proliferation, but cellular migration and invasion were reduced and sensitivity to anti-Hsp90 drugs was (+).

Doxorubicin

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [2]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: H69AR cells; Lung; Homo sapiens (Human); CVCL_3513
• Experiment for Molecule Alteration: MiRNA microarray
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Following transfection of the H69AR cells with the mimics of miR-134, miR-379 and miR-495, respectively, we treated the cells with a series of concentrations of Cisplatin, Etoposide and Doxorubicin. The effect of the mimics on sensitivity to these three chemotherapeutic drugs was significantly increased by 2.79-5.17-fold in H69AR cells. Meanwhile, the growth inhibition by chemotherapeutic drugs in H69AR cells was 1.37-1.53-fold greater in the antagomir-treated cells than that in control cells.

Etoposide

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [2]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: H69AR cells; Lung; Homo sapiens (Human); CVCL_3513
• Experiment for Molecule Alteration: MiRNA microarray
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Following transfection of the H69AR cells with the mimics of miR-134, miR-379 and miR-495, respectively, we treated the cells with a series of concentrations of Cisplatin, Etoposide and Doxorubicin. The effect of the mimics on sensitivity to these three chemotherapeutic drugs was significantly increased by 2.79-5.17-fold in H69AR cells. Meanwhile, the growth inhibition by chemotherapeutic drugs in H69AR cells was 1.37-1.53-fold greater in the antagomir-treated cells than that in control cells.

Gefitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [3]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Gefitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: PC9 cells; Lung; Homo sapiens (Human); CVCL_B260
• In Vitro Model: PC-14 cells; Lung; Homo sapiens (Human); CVCL_1640
• In Vitro Model: LC-2/ad cells; Lung; Homo sapiens (Human); CVCL_1373
• In Vitro Model: RERF-LCkJ cells; Lung; Homo sapiens (Human); CVCL_1654
• In Vitro Model: ABC-1 cells; Lung; Homo sapiens (Human); CVCL_1066
• In Vitro Model: RERF-LCMS cells; Lung; Homo sapiens (Human); CVCL_1655
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-134/487b/655 cluster contributed to the TGF-beta1-induced EMT phenomenon and affected the resistance to gefitinib by directly targeting MAGI2, in which suppression subsequently caused loss of PTEN stability in lung cancer cells.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [4]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastrointestinal stromal tumor [ICD-11: 2B5B.1] [5]

• Resistant Disease: Gastrointestinal stromal tumor [ICD-11: 2B5B.1]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: GIST882 cells; Gastric; Homo sapiens (Human); CVCL_7044
• In Vitro Model: GIST48 cells; Gastric; Homo sapiens (Human); CVCL_7041
• In Vivo Model: GIST patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR; Western blot
• Experiment for Drug Resistance: Cytotoxicity assay
• Mechanism Description: Functionally, miR-125a-5p expression modulated imatinib sensitivity in GIST882 cells with a homozygous KIT mutation but not in GIST48 cells with double KIT mutations. Overexpression of miR-125a-5p suppressed PTPN18 expression, and silencing of PTPN18 expression increased cell viability in GIST882 cells upon imatinib treatment.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] [6]

• Resistant Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: A2780 cells; Ovary; Homo sapiens (Human); CVCL_0134
• In Vitro Model: COC1 cells; Ovary; Homo sapiens (Human); CVCL_6891
• In Vitro Model: SkOV3-TR30 cells; Ovary; Homo sapiens (Human); CVCL_0532
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTS assay; Flow cytometry assay
• Mechanism Description: LINC01118 Can enhance ABCC1 expression by suppressing miR-134 expression to promote paclitaxel resistance in epithelial ovarian cancer.

References

• Ref 1: miR-134 in extracellular vesicles reduces triple-negative breast cancer aggression and increases drug sensitivity. Oncotarget. 2015 Oct 20;6(32):32774-89. doi: 10.18632/oncotarget.5192.
• Ref 2: Mutations in ABL kinase domain are associated with inferior progression-free survival. Leuk Lymphoma. 2010 Jun;51(6):1072-8. doi: 10.3109/10428191003729741.
• Ref 3: MiR-134/487b/655 cluster regulates TGF-Beta-induced epithelial-mesenchymal transition and drug resistance to gefitinib by targeting MAGI2 in lung adenocarcinoma cells. Mol Cancer Ther. 2014 Feb;13(2):444-53. doi: 10.1158/1535-7163.MCT-13-0448. Epub 2013 Nov 20.
• Ref 4: miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
• Ref 5: The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
• Ref 6: LINC01118 Modulates Paclitaxel Resistance of Epithelial Ovarian Cancer by Regulating miR-134/ABCC1. Med Sci Monit. 2018 Dec 6;24:8831-8839. doi: 10.12659/MSM.910932.