Molecule Information
General Information of the Molecule (ID: Mol01432)
Name |
hsa-mir-152
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 152
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR152
|
||||
Gene ID | |||||
Location |
chr17:48037161-48037247[-]
|
||||
Sequence |
UGUCCCCCCCGGCCCAGGUUCUGUGAUACACUCCGACUCGGGCUCUGGAGCAGUCAGUGC
AUGACAGAACUUGGGCCCGGAAGGACC Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Lung cancer | [1] | |||
Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
In Vivo Model | CD-1/CD-1 nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-152 and miR-185 were involved in cisplatin resistance, miR-152 and miR-185 increased cisplatin sensitivity mainly through the direct downregulation of DNMT1. DNMT1 is the most abundant DNA methyltransferase in mammalian cells and the key enzyme for the maintenance of hemimethylated DNA during DNA replication and de novo methylation during somatic cell development and differentiation. DNMT1 expression is also upregulated in many malignancies. | |||
Disease Class: Ovarian cancer | [1] | |||
Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 | |
A2780/DDP cells | Ovary | Homo sapiens (Human) | CVCL_D619 | |
In Vivo Model | CD-1/CD-1 nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-152 and miR-185 were involved in cisplatin resistance, miR-152 and miR-185 increased cisplatin sensitivity mainly through the direct downregulation of DNMT1. DNMT1 is the most abundant DNA methyltransferase in mammalian cells and the key enzyme for the maintenance of hemimethylated DNA during DNA replication and de novo methylation during somatic cell development and differentiation. DNMT1 expression is also upregulated in many malignancies. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [2] | |||
Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
c-Met/PI3K/AKT signaling pathway | Activation | hsa01521 | ||
In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay; Soft agar assay | |||
Mechanism Description | LncRNAPVT1 targets miR-152 to enhance chemoresistance of osteosarcoma to doxorubicin through activating c-MET/PI3k/AkT pathway. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Osteosarcoma | [2] | |||
Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Resistant Drug | Gemcitabine | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
c-Met/PI3K/AKT signaling pathway | Activation | hsa01521 | ||
In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay; Soft agar assay | |||
Mechanism Description | LncRNAPVT1 targets miR-152 to enhance chemoresistance of osteosarcoma to gemcitabine through activating c-MET/PI3k/AkT pathway. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Breast cancer | [3] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Tamoxifen | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Annexin V-FITC Apoptosis Detection assay; Flow cytometry assay | |||
Mechanism Description | miR148a and miR152 reduce tamoxifen resistance in ER+ breast cancer via downregulating ALCAM. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.