Molecule Information

General Information of the Molecule (ID: Mol01427)

• Name: hsa-mir-140 ,Homo sapiens
• Synonyms: microRNA 140
• Molecule Type: Precursor miRNA
• Gene Name: MIR140
• Gene ID: 406932
• Location: chr16:69933081-69933180[+]
• Sequence:
  UGUGUCUCUCUCUGUGUCCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUU
  CUACCACAGGGUAGAACCACGGACAGGAUACCGGGGCACC
• Ensembl ID: ENSG00000208017
• HGNC ID: HGNC:31527
• Precursor Accession: MI0000456

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [1]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: miR-140 is involved in the chemoresistance by reduced cell proliferation via G1 and G2 phase arrest mediated in part.

Disease Class: Colon cancer [1]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: miR-140 is involved in the chemoresistance by reduced cell proliferation via G1 and G2 phase arrest mediated in part.

Methotrexate

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Osteosarcoma [1]

• Sensitive Disease: Osteosarcoma [ICD-11: 2B51.0]
• Sensitive Drug: Methotrexate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: U2OS cells; Bone; Homo sapiens (Human); CVCL_0042
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: miR-140 is involved in the chemoresistance by reduced cell proliferation via G1 and G2 phase arrest mediated in part.

Disease Class: Colon cancer [1]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Methotrexate
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: WST-1 assay
• Mechanism Description: miR-140 is involved in the chemoresistance by reduced cell proliferation via G1 and G2 phase arrest mediated in part.

References

• Ref 1: Mechanism of chemoresistance mediated by miR-140 in human osteosarcoma and colon cancer cells. Oncogene. 2009 Nov 19;28(46):4065-74. doi: 10.1038/onc.2009.274. Epub 2009 Sep 7.