Molecule Information
General Information of the Molecule (ID: Mol01419)
| Name |
hsa-mir-130a
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 130a
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR130A
|
||||
| Gene ID | |||||
| Location |
chr11:57641198-57641286[+]
|
||||
| Sequence |
UGCUGCUGGCCAGAGCUCUUUUCACAUUGUGCUACUGUCUGCACCUGUCACUAGCAGUGC
AAUGUUAAAAGGGCAUUGGCCGUGUAGUG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [2] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CellTiter 96 aqueous one solution cell proliferation assay | |||
| Mechanism Description | miR-130a and miR-374a mimics decreased the sensitivity of A2780 cells to cisplatin, reversely, their inhibitors could resensitize A2780/DDP cells. Furthermore, overexpression of miR-130a could increase the MDR1 mRNA and P-gp levels in A2780 and A2780/DDP cells, whereas knockdown of miR-130a could inhibit MDR1 gene expression and upregulate the PTEN protein expression. In a conclusion, the deregulation of miR-374a and miR-130a may be involved in the development and regulation of cisplatin resistance in ovarian cancer cells. This role of miR-130a may be achieved by regulating the MDR1 and PTEN gene expression. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [3], [4] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| miR130a/XIAP signaling pathway | Regulation | N.A. | ||
| In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
| A2780/DDP cells | Ovary | Homo sapiens (Human) | CVCL_D619 | |
| Experiment for Molecule Alteration |
qRT-PCR; Northern blotting analysis | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Overexpression of miR-130a could suppress XIAP expression and sensitize A2780/DDP cells to cisplatin. And finally downstreamtarget validation was proven for the miR-130a, whose downregulation was linked to the translational activation of the M-CSF gene, a knownresistance factor for ovarian cancer. | |||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.2] | [5] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.2] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell adhesion | Inhibition | hsa04514 | |
| Cell apoptosis | Inhibition | hsa04210 | ||
| Cell migration | Activation | hsa04670 | ||
| Cell proliferation | Activation | hsa05200 | ||
| Wnt/Beta-catenin signaling pathway | Activation | hsa04310 | ||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HEK293 cells | Kidney | Homo sapiens (Human) | CVCL_0045 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Oncogenic activation of the Wnt/beta-catenin signaling pathway is common in HCC. Upregulated miR-130a inhibited RUNX3 expression, which resulted in activation of Wnt/beta-catenin signaling and sequent cisplatin resistance. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [6] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | PI3K/AKT/PTEN/mTOR signaling pathway | Activation | hsa04151 | |
| In Vitro Model | SkOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0532 |
| SkOV3/CIS cells | Ovary | Homo sapiens (Human) | CVCL_UI88 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-130a, acting as an intermediate, might regulate cisplatin resistance by activating PI3k/Akt/PTEN/mTOR and ABC superfamily drug transporter pathways in ovarian cancer cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.0] | [7] | |||
| Resistant Disease | Head and neck squamous cell carcinoma [ICD-11: 2D42.0] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Cytotoxic Assay | |||
| Mechanism Description | MicroRNAs (miRNAs) are a family of short (approximately 22 nucleotides), endogenous, non-coding regulatory RNAs that can posttranscriptionally regulate gene expression through sequence-specific base paring with target mRNAs. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.0] | [7] | |||
| Resistant Disease | Head and neck squamous cell carcinoma [ICD-11: 2D42.0] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Cytotoxic Assay | |||
| Mechanism Description | MicroRNAs (miRNAs) are a family of short (approximately 22 nucleotides), endogenous, non-coding regulatory RNAs that can posttranscriptionally regulate gene expression through sequence-specific base paring with target mRNAs. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [8] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Gefitinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | H1975 cells | Lung | Homo sapiens (Human) | CVCL_1511 |
| A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| PC9GR cells | Lung | Homo sapiens (Human) | CVCL_V337 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | Expression of Met has been associated with both primary and acquired resistance to gefitinib, miR-130a expression was negatively correlated with that of Met. Over-expression of miR-130a increased cell apoptosis and inhibited proliferation of NSCLC cells treated with gefitinib, whereas lowering the expression of miR-130a decreased cell apoptosis and promoted cell proliferation after treatment with gefitinib in both gefitinib-sensitive and -resistant NSCLC cell lines. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [9] | |||
| Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | J82 cells | Bladder | Homo sapiens (Human) | CVCL_0359 |
| UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
| RT4 cells | Bladder | Homo sapiens (Human) | CVCL_0036 | |
| RT112 cells | Bladder | Homo sapiens (Human) | CVCL_1670 | |
| Experiment for Molecule Alteration |
Western blot; Microarray Analysis; qRT-PCR | |||
| Experiment for Drug Resistance |
Proliferation Assay | |||
| Mechanism Description | Within this group, let-7b and let-7i exhibited decreased expression, while miR-1290 and miR-138 displayed increased expression levels in gemcitabine-resistant cells | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [10] | |||
| Sensitive Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Sensitive Drug | Imatinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| p53 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | BCL-2, MCL-1 and XIAP were the target genes of miR-130a. BCL-2, MCL-1, TCL-1 and XIAP protein levels were significantly higher in patients with drug-sensitive CML cells. Transfected miR-130a mimics significantly decreased the protein expression of BCL-1, MCL-1 and XIAP. Transfected miR-130a significantly increased the CML sensitivity to Gleevec. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.0] | [7] | |||
| Resistant Disease | Head and neck squamous cell carcinoma [ICD-11: 2D42.0] | |||
| Resistant Drug | Methotrexate | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Cytotoxic Assay | |||
| Mechanism Description | MicroRNAs (miRNAs) are a family of short (approximately 22 nucleotides), endogenous, non-coding regulatory RNAs that can posttranscriptionally regulate gene expression through sequence-specific base paring with target mRNAs. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Prostate cancer [ICD-11: 2C82.0] | [11] | |||
| Resistant Disease | Prostate cancer [ICD-11: 2C82.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Caspase-3 signaling pathway | Activation | hsa04210 | |
| Cell apoptosis | Inhibition | hsa04210 | ||
| In Vitro Model | PC3 cells | Prostate | Homo sapiens (Human) | CVCL_0035 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CellTiter-Glo luminescent cell viability assay | |||
| Mechanism Description | Restoration of miR-130a activated caspase-8 and increased the drug sensitivity in taxane-resistant prostate cancer cells, suggesting that miR-130a may become a potential target for therapy of taxane-resistant CRPC. Since the mechanism of the action of miR-130a was different from that of paclitaxel, a combination therapy of paclitaxel and miR-130a mimic may be effective in treatment of CRPC. Furthermore, it was reported that miR-130a expression was decreased in prostate cancer tissues. It is therefore possible that the restoration of miR-130a could be an effective approach for treating not only taxane-resistant prostate cancer but also prostate cancer with reduced expression of miR-130a. | |||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [3] | |||
| Resistant Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Resistant Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | A2780 cells | Ovary | Homo sapiens (Human) | CVCL_0134 |
| A2780CIS cells | Ovary | Homo sapiens (Human) | CVCL_1942 | |
| Experiment for Molecule Alteration |
qRT-PCR; Northern blotting analysis | |||
| Experiment for Drug Resistance |
Clonogenic assay | |||
| Mechanism Description | Finally downstreamtarget validation was proven for the miR-130a, whose downregulation was linked to the translational activation of the M-CSF gene, a knownresistance factor for ovarian cancer. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] | [12] | |||
| Resistant Disease | Hepatocellular carcinoma [ICD-11: 2C12.0] | |||
| Resistant Drug | Sorafenib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 |
| Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 | |
| Experiment for Molecule Alteration |
RT-PCR; Western blot; Luciferase assay | |||
| Experiment for Drug Resistance |
Cytotoxicity assay; Apoptosis assays | |||
| Mechanism Description | Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis. | |||
Clinical Trial Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [13] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | TRAIL | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell migration | Activation | hsa04670 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 | |
| A459 cells | Lung | Homo sapiens (Human) | CVCL_0023 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-130a, expressed at low level in lung cancer cell lines, by targeting MET was able to reduce TRAIL resistance in NSCLC cells through the c-Jun mediated downregulation of miR-221 and miR-222. | |||
Investigative Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Epithelial ovarian cancer [ICD-11: 2B5D.0] | [14] | |||
| Resistant Disease | Epithelial ovarian cancer [ICD-11: 2B5D.0] | |||
| Resistant Drug | Platinum | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| PI3K/AKT signaling pathway | Activation | hsa04151 | ||
| In Vitro Model | Epithelial ovarian cancer patients | Ovary | Homo sapiens (Human) | N.A. |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CellTiter 96 aqueous one solution cell proliferation assay | |||
| Mechanism Description | miR-130a may mediate the generation of platinum resistance in epithelial ovarian cancer through inhibiting PTEN to activate PI3k/AkT signaling pathway and increasing BCL-2 to inhibit tumor cell apoptosis. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
