Molecule Information
General Information of the Molecule (ID: Mol01415)
| Name |
hsa-mir-124
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 124-1
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR124-1
|
||||
| Gene ID | |||||
| Location |
chr8:9903388-9903472[-]
|
||||
| Sequence |
AGGCCUCUCUCUCCGUGUUCACAGCGGACCUUGAUUUAAAUGUCCAUACAAUUAAGGCAC
GCGGUGAAUGCCAAGAAUGGGGCUG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Acute lymphocytic leukemia [ICD-11: 2B33.0] | [1] | |||
| Resistant Disease | Acute lymphocytic leukemia [ICD-11: 2B33.0] | |||
| Resistant Drug | Dexamethasone | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| In Vitro Model | Jurkat cells | Pleural effusion | Homo sapiens (Human) | CVCL_0065 |
| CCRF-CEM cells | Pleural effusion | Homo sapiens (Human) | CVCL_0207 | |
| CEM/C1 cells | Peripheral blood | Homo sapiens (Human) | CVCL_3496 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis | |||
| Mechanism Description | miR124 contributes to glucocorticoid resistance in acute lymphoblastic leukemia by promoting proliferation, inhibiting apoptosis and targeting NR3C1. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | STAT3/HIF-1 signaling pathway | Inhibition | hsa04066 | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-124 sensitizes DOX-resistant BCSCs to DOX by modulating the STAT3 and HIF-1 signaling pathways. | |||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [3] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
| HCC1937 cells | Breast | Homo sapiens (Human) | CVCL_0290 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
| HCC1937 cells | Breast | Homo sapiens (Human) | CVCL_0290 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [4] | |||
| Sensitive Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Sensitive Drug | Erlotinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | BxPC-3 cells | Pancreas | Homo sapiens (Human) | CVCL_0186 |
| Capan-1 cells | Pancreas | Homo sapiens (Human) | CVCL_0237 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-124 overexpression was able to sensitize the response of Capan-1 cells to erlotinib through inhibiting EphA2. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [3] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
| HCC1937 cells | Breast | Homo sapiens (Human) | CVCL_0290 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Etoposide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
| HCC1937 cells | Breast | Homo sapiens (Human) | CVCL_0290 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] | [5] | |||
| Sensitive Disease | Non-small cell lung cancer [ICD-11: 2C25.Y] | |||
| Sensitive Drug | Gefitinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| PC9 cells | Lung | Homo sapiens (Human) | CVCL_B260 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Annexin V-FITC Apoptosis assay | |||
| Mechanism Description | miR124 decreased SNAI2 and STAT3 expression by directly targeting their 3'UTRs, miR124 contributes to gefitinib and EMT by directly targeting SNAI2 and STAT3. Over-expression of miR124 re-sensitized gefitinib-resistant cell lines to gefitinib. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Glioblastoma [ICD-11: 2A00.02] | [6] | |||
| Sensitive Disease | Glioblastoma [ICD-11: 2A00.02] | |||
| Sensitive Drug | Temozolomide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | LN229 cells | Brain | Homo sapiens (Human) | CVCL_0393 |
| A172 cells | Brain | Homo sapiens (Human) | CVCL_0131 | |
| T98G cells | Brain | Homo sapiens (Human) | CVCL_0556 | |
| M059J cells | Brain | Homo sapiens (Human) | CVCL_0400 | |
| M059k cells | Brain | Homo sapiens (Human) | CVCL_0401 | |
| U-87 MG cells | Brain | Homo sapiens (Human) | CVCL_0022 | |
| U118 MG cells | Brain | Homo sapiens (Human) | CVCL_0633 | |
| U138-MG cells | Brain | Homo sapiens (Human) | CVCL_0020 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | miR124 suppresses glioblastoma growth and potentiates chemosensitivity by inhibiting AURkA. Re-expression of AURkA rescued miR124-mediated growth suppression. | |||
Clinical Trial Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [3] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Camptothecin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
| HCC1937 cells | Breast | Homo sapiens (Human) | CVCL_0290 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Camptothecin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
| HCC1937 cells | Breast | Homo sapiens (Human) | CVCL_0290 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance. | |||
Investigative Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Osteosarcoma [ICD-11: 2B51.0] | [3] | |||
| Sensitive Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
| Sensitive Drug | Iridium | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
| HCC1937 cells | Breast | Homo sapiens (Human) | CVCL_0290 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance. | |||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Iridium | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | MDA-MB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 |
| T47D cells | Breast | Homo sapiens (Human) | CVCL_0553 | |
| ZR75-1 cells | Breast | Homo sapiens (Human) | CVCL_0588 | |
| HCC1937 cells | Breast | Homo sapiens (Human) | CVCL_0290 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-124 may be involved in DNA repair by directly targeting ATMIN and PARP1, suggesting that multiple DNA repair pathways are affected by miR-124 and therefore manipulation of miR-124 level/activity may improve the efficacy of chemotherapies that induce DNA damage. repression of ATMIN (+) the HR repair defect induced by miR-124, and restoration of ATMIN reversed the effect of miR-124 overexpression in breast cancer cells. Therefore, it is intriguing to further speculate which of the multiple roles of ATMIN is specifically affected in breast carcinogenesis. On the other hand, PARP1-mediated processes play a role in oncogenesis, cancer progression, and therapeutic resistance. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
