Molecule Information
General Information of the Molecule (ID: Mol01410)
Name |
hsa-mir-15b
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 15b
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR15B
|
||||
Gene ID | |||||
Location |
chr3:160404588-160404685[+]
|
||||
Sequence |
UUGAGGCCUUAAAGUACUGUAGCAGCACAUCAUGGUUUACAUGCUACAGUCAAGAUGCGA
AUCAUUAUUUGCUGCUCUAGAAAUUUAAGGAAAUUCAU Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Tongue cancer | [1] | |||
Resistant Disease | Tongue cancer [ICD-11: 2B62.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | SHH/GLI1 signaling pathway | Activation | hsa05217 | |
In Vitro Model | CAL27 cells | Oral | Homo sapiens (Human) | CVCL_1107 |
SCC25 cells | Oral | Homo sapiens (Human) | CVCL_1682 | |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | Overexpression of BMI1 alters cell proliferation, apoptosis and stem cell self-renewal and correlates with the invasion and metastasis of several human cancers. BMI1 overexpression due to reduction of miR-200b and miR-15b may result in chemotherapy-induced EMT in TSCCs via these pathways. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Mitochondrial signaling pathway | Activation | hsa04217 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2. | |||
|
||||
Disease Class: Oral tongue squamous cell cancer | [3] | |||
Sensitive Disease | Oral tongue squamous cell cancer [ICD-11: 2B62.3] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | SCC25 cells | Oral | Homo sapiens (Human) | CVCL_1682 |
SCC25-res cells | Tongue | Homo sapiens (Human) | CVCL_A5BQ | |
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Soft agar assay | |||
Mechanism Description | miR15b inhibits cancer-initiating cell phenotypes and chemoresistance of cisplatin by targeting TRIM14 in oral tongue squamous cell cancer Overexpression of TRIM14 induced EMT phenotype. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Mitochondrial signaling pathway | Activation | hsa04217 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Etoposide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Mitochondrial signaling pathway | Activation | hsa04217 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [2] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Vincristine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Mitochondrial signaling pathway | Activation | hsa04217 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
SGC7901/VCR cells | Gastric | Homo sapiens (Human) | CVCL_VU58 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.