Molecule Information

General Information of the Molecule (ID: Mol01410)

• Name: hsa-mir-15b ,Homo sapiens
• Synonyms: microRNA 15b
• Molecule Type: Precursor miRNA
• Gene Name: MIR15B
• Gene ID: 406949
• Location: chr3:160404588-160404685[+]
• Sequence:
  UUGAGGCCUUAAAGUACUGUAGCAGCACAUCAUGGUUUACAUGCUACAGUCAAGAUGCGA
  AUCAUUAUUUGCUGCUCUAGAAAUUUAAGGAAAUUCAU
• Ensembl ID: ENSG00000207779
• HGNC ID: HGNC:31544
• Precursor Accession: MI0000438

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Tongue cancer [ICD-11: 2B62.0] [1]

• Resistant Disease: Tongue cancer [ICD-11: 2B62.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: SHH/GLI1 signaling pathway; Activation; hsa05217
• In Vitro Model: CAL27 cells; Oral; Homo sapiens (Human); CVCL_1107
• In Vitro Model: SCC25 cells; Oral; Homo sapiens (Human); CVCL_1682
• In Vivo Model: BALB/c nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of BMI1 alters cell proliferation, apoptosis and stem cell self-renewal and correlates with the invasion and metastasis of several human cancers. BMI1 overexpression due to reduction of miR-200b and miR-15b may result in chemotherapy-induced EMT in TSCCs via these pathways.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Mitochondrial signaling pathway; Activation; hsa04217
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Oral tongue squamous cell cancer [ICD-11: 2B62.3] [3]

• Sensitive Disease: Oral tongue squamous cell cancer [ICD-11: 2B62.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SCC25 cells; Oral; Homo sapiens (Human); CVCL_1682
• In Vitro Model: SCC25-res cells; Tongue; Homo sapiens (Human); CVCL_A5BQ
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Soft agar assay
• Mechanism Description: miR15b inhibits cancer-initiating cell phenotypes and chemoresistance of cisplatin by targeting TRIM14 in oral tongue squamous cell cancer Overexpression of TRIM14 induced EMT phenotype.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Mitochondrial signaling pathway; Activation; hsa04217
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.

Etoposide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Mitochondrial signaling pathway; Activation; hsa04217
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [2]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Mitochondrial signaling pathway; Activation; hsa04217
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901/VCR cells; Gastric; Homo sapiens (Human); CVCL_VU58
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.

References

• Ref 1: MiR-200b and miR-15b regulate chemotherapy-induced epithelial-mesenchymal transition in human tongue cancer cells by targeting BMI1. Oncogene. 2012 Jan 26;31(4):432-45. doi: 10.1038/onc.2011.263. Epub 2011 Jul 4.
• Ref 2: miR-15b and miR-16 modulate multidrug resistance by targeting BCL2 in human gastric cancer cells. Int J Cancer. 2008 Jul 15;123(2):372-379. doi: 10.1002/ijc.23501.
• Ref 3: miR-15b inhibits cancer-initiating cell phenotypes and chemoresistance of cisplatin by targeting TRIM14 in oral tongue squamous cell cancer. Oncol Rep. 2017 May;37(5):2720-2726. doi: 10.3892/or.2017.5532. Epub 2017 Mar 27.