Molecule Information

General Information of the Molecule (ID: Mol01410)
Name
hsa-mir-15b ,Homo sapiens
Synonyms
microRNA 15b
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR15B
Gene ID
406949
Location
chr3:160404588-160404685[+]
Sequence
UUGAGGCCUUAAAGUACUGUAGCAGCACAUCAUGGUUUACAUGCUACAGUCAAGAUGCGA
AUCAUUAUUUGCUGCUCUAGAAAUUUAAGGAAAUUCAU
    Click to Show/Hide
Ensembl ID
ENSG00000207779
HGNC ID
HGNC:31544
Precursor Accession
MI0000438
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [1]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model DLD-1 cells Colon Homo sapiens (Human) CVCL_0248
KM12C cells Colon Homo sapiens (Human) CVCL_9547
DLD-1 cells Colon Homo sapiens (Human) CVCL_0248
KM12C cells Colon Homo sapiens (Human) CVCL_9547
Experiment for
Molecule Alteration		 MiRNA microarray; qRT-PCR; mRNA immunoprecipitation
Experiment for
Drug Resistance		 Cell proliferation assay; Flow cytometry
Mechanism Description We revealed up-regulation of miR-19b in response to 5-FU and potential targets of miR-19b mediating the cell cycle under treatment with 5-FU.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Tongue cancer [ICD-11: 2B62.0] [2]
Resistant Disease Tongue cancer [ICD-11: 2B62.0]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation SHH/GLI1 signaling pathway Activation hsa05217
In Vitro Model CAL27 cells Oral Homo sapiens (Human) CVCL_1107
SCC25 cells Oral Homo sapiens (Human) CVCL_1682
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Overexpression of BMI1 alters cell proliferation, apoptosis and stem cell self-renewal and correlates with the invasion and metastasis of several human cancers. BMI1 overexpression due to reduction of miR-200b and miR-15b may result in chemotherapy-induced EMT in TSCCs via these pathways.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Mitochondrial signaling pathway Activation hsa04217
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Oral tongue squamous cell cancer [ICD-11: 2B62.3] [4]
Sensitive Disease Oral tongue squamous cell cancer [ICD-11: 2B62.3]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SCC25 cells Oral Homo sapiens (Human) CVCL_1682
SCC25-res cells Tongue Homo sapiens (Human) CVCL_A5BQ
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Soft agar assay
Mechanism Description miR15b inhibits cancer-initiating cell phenotypes and chemoresistance of cisplatin by targeting TRIM14 in oral tongue squamous cell cancer Overexpression of TRIM14 induced EMT phenotype.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Mitochondrial signaling pathway Activation hsa04217
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.
Etoposide
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Etoposide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Mitochondrial signaling pathway Activation hsa04217
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [5]
Resistant Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
 Disease Info 
Resistant Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SW1990 cells Pancreas Homo sapiens (Human) CVCL_1723
SW1990 cells Pancreas Homo sapiens (Human) CVCL_1723
Experiment for
Molecule Alteration		 qPCR
Mechanism Description Differential gene expression between parental and gemcitabine-resistant pancreatic cancer cell. Consequently, compared with SW1990 cells, 28 microRNAs were upregulated and 28 microRNAs were decreased (fold change>=2) in SW1990/GEM cells. Then, the expression of some differential microRNAs was confirmed by Q-PCR assays. We found that miR-643, miR-1261, miR483-5p, miR-371a-5p, and miR-373-3p were upregulated and that the expression of miR-4455, miR-3676, miR-4650, miR4791, and miR-4644 was decreased in SW1990/GEM cells. Generally, the tendency of expression changes was consistent between microRNA-seq and Q-PCR results.
Oxaliplatin
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [7]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Oxaliplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
HCT8 cells Colon Homo sapiens (Human) CVCL_2478
LS174T cells Colon Homo sapiens (Human) CVCL_1384
LOVO cells Colon Homo sapiens (Human) CVCL_0399
In Vivo Model Colorectal cancer patients; NOD SCID mouse xenograft model Homo sapiens
Experiment for
Molecule Alteration		 RT-qPCR; Luciferase Reporter Assay; Western blot
Experiment for
Drug Resistance		 Cell Growth assays; Cell spreading assays; Motility assays; Invasion assays; Tumor growth and metastasis assay; Flow cytometry analysis; Spheroid formation assay; Cell cytotoxicity assay; Clonogenic survival assay
Mechanism Description Enhancement of Sensitivity to Chemo/Radiation Therapy by Using miR-15b against DCLK1 in Colorectal Cancer
Paclitaxel
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [8]
Sensitive Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MDA-MB-435 cells Breast Homo sapiens (Human) CVCL_0417
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MDA-MB-436 cells Breast Homo sapiens (Human) CVCL_0623
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
BT474 cells Breast Homo sapiens (Human) CVCL_0179
Experiment for
Molecule Alteration		 miRNA Microarray Expression Analysis; qRT-PCR; RT-PCR; Luciferase Reporter Assay; Western blot
Experiment for
Drug Resistance		 Apoptosis Assay; Cell Viability Assay
Mechanism Description Taken together, our data strongly support a central role for miR-125b in conferring Taxol resistance through the suppression of Bak1 expression.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [9]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Verapamil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.1] [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
 Disease Info 
Sensitive Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Mitochondrial signaling pathway Activation hsa04217
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901/VCR cells Gastric Homo sapiens (Human) CVCL_VU58
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-15b and miR-16, among the downregulated miRNAs in SGC7901/VCR cells, were demonstrated to play a role in the development of MDR in gastric cancer cells by targeting the antiapoptotic gene BCL2.
References
Ref 1 Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.
Ref 2 MiR-200b and miR-15b regulate chemotherapy-induced epithelial-mesenchymal transition in human tongue cancer cells by targeting BMI1. Oncogene. 2012 Jan 26;31(4):432-45. doi: 10.1038/onc.2011.263. Epub 2011 Jul 4.
Ref 3 miR-15b and miR-16 modulate multidrug resistance by targeting BCL2 in human gastric cancer cells. Int J Cancer. 2008 Jul 15;123(2):372-379. doi: 10.1002/ijc.23501.
Ref 4 miR-15b inhibits cancer-initiating cell phenotypes and chemoresistance of cisplatin by targeting TRIM14 in oral tongue squamous cell cancer. Oncol Rep. 2017 May;37(5):2720-2726. doi: 10.3892/or.2017.5532. Epub 2017 Mar 27.
Ref 5 The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
Ref 6 The fibroblast growth factor receptor genetic status as a potential predictor of the sensitivity to CH5183284/Debio 1347, a novel selective FGFR inhibitorMol Cancer Ther. 2014 Nov;13(11):2547-58. doi: 10.1158/1535-7163.MCT-14-0248. Epub 2014 Aug 28.
Ref 7 Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
Ref 8 MicroRNA-125b confers the resistance of breast cancer cells to paclitaxel through suppression of pro-apoptotic Bcl-2 antagonist killer 1 (Bak1) expression. J Biol Chem. 2010 Jul 9;285(28):21496-507. doi: 10.1074/jbc.M109.083337. Epub 2010 May 11.
Ref 9 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.