Molecule Information

General Information of the Molecule (ID: Mol01406)

• Name: hsa-mir-224 ,Homo sapiens
• Synonyms: microRNA 224
• Molecule Type: Precursor miRNA
• Gene Name: MIR224
• Gene ID: 407009
• Location: chrX:151958578-151958658[-]
• Sequence:
  GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGU
  GCCCUAGUGACUACAAAGCCC
• Ensembl ID: ENSG00000284363
• HGNC ID: HGNC:31604
• Precursor Accession: MI0000301

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 12 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [1]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Intrinsic mitochondrial death signaling pathway; Inhibition; hsa4210)
• Cell Pathway Regulation: p21; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-224 could promote the in vitro and in vivo DDP resistance of LA cells via regulating G1/S cell cycle transition and apoptosis. p21WAF1/CIP1, a potent cyclin-dependent kinase inhibitor, was identified as the direct and functional target gene of miR-224. Overexpression of p21WAF1/CIP1 could phenocopy the effect of miR-224 downregulation and silencing of p21WAF1/CIP1 could partially reverse the effect of miR-224 downregulation on DDP resistance of DDP-resistant LA cells. In addition, miR-224 could affect the G1/S transition of cell cycle and apoptosis in LA cells through the p21WAF1/CIP1-pRb pathway and the intrinsic mitochondrial death pathway. Furthermore, miR-224 was found to be downregulated in DDP-responding LA tissues, and its expression was inversely correlated with p21WAF1/CIP1. Multivariate analyses indicated that the status of miR-224 might be an independent prognostic factor for predicting the survival of LA patients.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [2]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: DESC1/EGFR/AKT signaling pathway; Regulation; N.A.
• In Vitro Model: KYSE30 cells; Esophagus; Homo sapiens (Human); CVCL_1351
• In Vitro Model: EC9706 cells; Esophagus; Homo sapiens (Human); CVCL_E307
• In Vitro Model: KYSE140 cells; Esophagus; Homo sapiens (Human); CVCL_1347
• In Vitro Model: TE13 cells; Esophageal; Homo sapiens (Human); CVCL_4463
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: TUSC7 suppressed the proliferation and chemotherapy resistance of ESCC cells by increasing DESC1 expression via inhibiting miR-224.

Cyclophosphamide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.1] [3]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.1]
• Resistant Drug: Cyclophosphamide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Diffuse large B cell lymphoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: MicroRNAs (miRNAs) are small, non-coding RNAs that posttranscriptionally regulate gene expression via suppression of specific target mRNAs.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [4]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Wnt/Beta-catenin signaling pathway; Regulation; N.A.
• In Vitro Model: SW480 cells; Colon; Homo sapiens (Human); CVCL_0546
• In Vitro Model: SW480/ADM cells; Colon; Homo sapiens (Human); CVCL_0546
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay; EdU staining
• Mechanism Description: miR224 up-regulation is associated with ADM resistance of CRC cells. Suppression of miR224 expression up-regulated GSk-3beta expression, inhibited Wnt/beta-catenin signal pathway activity and Survivin expression, as well as reduced ADM resistance of CRC SW480 cells.

Erlotinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [5]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Erlotinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Hypoxia signalling; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• Experiment for Molecule Alteration: High-throughput miRNA analysis
• Experiment for Drug Resistance: Sulforhodamine-B assay
• Mechanism Description: Expression of 13 miRNA genes predicts response to EGFR inhibition in cancer cell lines and tumours, and discriminates primary from metastatic tumours. Signature genes target proteins that are enriched for epithelial-to-mesenchymal transition (EMT) genes. Epithelial-to-mesenchymal transition predicts EGFR inhibitor resistance and metastatic behaviour. The EMT transcription factor, ZEB1, shows altered expression in erlotinib-sensitive NSCLC and PDAC, where many signature miRNA genes are upregulated. Ectopic expression of mir-200c alters expression of EMT proteins, sensitivity to erlotinib, and migration in lung cells. Treatment with TGFbeta1 changes expression of signature miRNA and EMT proteins and modulates migration in lung cells.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [2]

• Sensitive Disease: Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: DESC1/EGFR/AKT signaling pathway; Regulation; N.A.
• In Vitro Model: KYSE30 cells; Esophagus; Homo sapiens (Human); CVCL_1351
• In Vitro Model: EC9706 cells; Esophagus; Homo sapiens (Human); CVCL_E307
• In Vitro Model: KYSE140 cells; Esophagus; Homo sapiens (Human); CVCL_1347
• In Vitro Model: TE13 cells; Esophageal; Homo sapiens (Human); CVCL_4463
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: TUSC7 suppressed the proliferation and chemotherapy resistance of ESCC cells by increasing DESC1 expression via inhibiting miR-224.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [6]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT asssay; Innocyte invasion assay
• Mechanism Description: microRNA-224 was differentially expressed in dysplastic colorectal disease and in isogeneic kRAS WT and mutant HCT116 cells. Antagomir-mediated miR-224 silencing in HCT116 kRAS WT cells phenocopied kRAS mutation, increased kRAS activity and ERk and AkT phosphorylation. 5-FU chemosensitivity was significantly increased in miR-224 knockdown cells, and in NIH3T3 cells expressing kRAS and BRAF mutant proteins. Bioinformatics analysis of predicted miR-224 target genes predicted altered cell proliferation, invasion and epithelial-mesenchymal transition (EMT) phenotypes that were experimentally confirmed in miR-224 knockdown cells.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [7]

• Resistant Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• In Vitro Model: SW1990 cells; Pancreas; Homo sapiens (Human); CVCL_1723
• Experiment for Molecule Alteration: qPCR
• Mechanism Description: Differential gene expression between parental and gemcitabine-resistant pancreatic cancer cell. Consequently, compared with SW1990 cells, 28 microRNAs were upregulated and 28 microRNAs were decreased (fold change>=2) in SW1990/GEM cells. Then, the expression of some differential microRNAs was confirmed by Q-PCR assays. We found that miR-643, miR-1261, miR483-5p, miR-371a-5p, and miR-373-3p were upregulated and that the expression of miR-4455, miR-3676, miR-4650, miR4791, and miR-4644 was decreased in SW1990/GEM cells. Generally, the tendency of expression changes was consistent between microRNA-seq and Q-PCR results.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [8]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTS assay; Flow cytometric analysis; CFU assay
• Mechanism Description: miR224 and let-7i regulate the proliferation and chemosensitivity of CML cells probably via targeting ST3GAL IV.

Methotrexate

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [ICD-11: 2B90.1] [9]

• Resistant Disease: Colon cancer [ICD-11: 2B90.1]
• Resistant Drug: Methotrexate
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HT29 Cells; Colon; Homo sapiens (Human); CVCL_A8EZ
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: The endogenous overexpression of CDS2, DCP2, HSPC159, MYST3 and SLC4A4 in MTX-resistant HT29 cells. Inhibition of miR-224 with anti-miR224 produced an increase in the mRNA levels of CDS2, HSPC159, MYST3 and SLC4A4. Decreased mRNA levels of SLC4A4, CDS2 and HSPC159 cause an increase in MTX sensitivity in HT29 cells.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Cervical cancer [ICD-11: 2C77.0] [10]

• Sensitive Disease: Cervical cancer [ICD-11: 2C77.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Siha cells; Cervix uteri; Homo sapiens (Human); CVCL_0032
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Cytotoxicity assays
• Mechanism Description: Upregulation of microRNA-224 sensitizes human cervical cells SiHa to paclitaxel

Prednisone

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.1] [3]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.1]
• Resistant Drug: Prednisone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Diffuse large B cell lymphoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: MicroRNAs (miRNAs) are small, non-coding RNAs that posttranscriptionally regulate gene expression via suppression of specific target mRNAs.

Sorafenib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [11]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Sorafenib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: RT-PCR; Western blot; Luciferase assay
• Experiment for Drug Resistance: Cytotoxicity assay; Apoptosis assays
• Mechanism Description: Cellular expression of full-length HCV increases sensitivity to sorafenib by the miRNA-dependent modulation of Mcl-1 and apoptosis.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.1] [3]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.1]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Diffuse large B cell lymphoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: MicroRNAs (miRNAs) are small, non-coding RNAs that posttranscriptionally regulate gene expression via suppression of specific target mRNAs.

Clinical Trial Drug(s) 1 drug(s) in total

Hydroxycamptothecin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [12]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Hydroxycamptothecin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: BGC-823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: MGC-803 cells; Gastric; Homo sapiens (Human); CVCL_5334
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: NCI-N87 cells; Gastric; Homo sapiens (Human); CVCL_1603
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• Experiment for Molecule Alteration: MiRNA microarray profiling, qRT-PCR
• Experiment for Drug Resistance: A sulforhodamine B (SRB) assay
• Mechanism Description: MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs.

References

• Ref 1: MiR-224 promotes the chemoresistance of human lung adenocarcinoma cells to cisplatin via regulating G /S transition and apoptosis by targeting p21(WAF1/CIP1). Br J Cancer. 2014 Jul 15;111(2):339-54. doi: 10.1038/bjc.2014.157. Epub 2014 Jun 12.
• Ref 2: LncRNA-TUSC7/miR-224 affected chemotherapy resistance of esophageal squamous cell carcinoma by competitively regulating DESC1. J Exp Clin Cancer Res. 2018 Mar 12;37(1):56. doi: 10.1186/s13046-018-0724-4.
• Ref 3: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 4: The effect of miR-224 down-regulation on SW80 cell proliferation and apoptosis and weakening of ADM drug resistance. Eur Rev Med Pharmacol Sci. 2017 Nov;21(21):5008-5016.
• Ref 5: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 6: MicroRNA-224 is associated with colorectal cancer progression and response to 5-fluorouracil-based chemotherapy by KRAS-dependent and -independent mechanisms. Br J Cancer. 2015 Apr 28;112(9):1480-90. doi: 10.1038/bjc.2015.125.
• Ref 7: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 8: Downregulation of miR-224 and let-7i contribute to cell survival and chemoresistance in chronic myeloid leukemia cells by regulating ST3GAL IV expression. Gene. 2017 Aug 30;626:106-118. doi: 10.1016/j.gene.2017.05.030. Epub 2017 May 13.
• Ref 9: Underexpression of miR-224 in methotrexate resistant human colon cancer cells. Biochem Pharmacol. 2011 Dec 1;82(11):1572-82. doi: 10.1016/j.bcp.2011.08.009. Epub 2011 Aug 16.
• Ref 10: Altiratinib Inhibits Tumor Growth, Invasion, Angiogenesis, and Microenvironment-Mediated Drug Resistance via Balanced Inhibition of MET, TIE2, and VEGFR2Mol Cancer Ther. 2015 Sep;14(9):2023-34. doi: 10.1158/1535-7163.MCT-14-1105. Epub 2015 Aug 18.
• Ref 11: Downregulation of miR-21 enhances chemotherapeutic effect of taxol in breast carcinoma cells. Technol Cancer Res Treat. 2010 Feb;9(1):77-86. doi: 10.1177/153303461000900109.
• Ref 12: MicroRNA-141 confers resistance to cisplatin-induced apoptosis by targeting YAP1 in human esophageal squamous cell carcinoma. J Hum Genet. 2011 Apr;56(4):270-6. doi: 10.1038/jhg.2011.1. Epub 2011 Feb 3.