Molecule Information
General Information of the Molecule (ID: Mol01406)
| Name |
hsa-mir-224
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 224
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR224
|
||||
| Gene ID | |||||
| Location |
chrX:151958578-151958658[-]
|
||||
| Sequence |
GGGCUUUCAAGUCACUAGUGGUUCCGUUUAGUAGAUGAUUGUGCAUUGUUUCAAAAUGGU
GCCCUAGUGACUACAAAGCCC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] | [1] | |||
| Resistant Disease | Lung adenocarcinoma [ICD-11: 2C25.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Intrinsic mitochondrial death signaling pathway | Inhibition | hsa4210) | ||
| p21 | Regulation | N.A. | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-224 could promote the in vitro and in vivo DDP resistance of LA cells via regulating G1/S cell cycle transition and apoptosis. p21WAF1/CIP1, a potent cyclin-dependent kinase inhibitor, was identified as the direct and functional target gene of miR-224. Overexpression of p21WAF1/CIP1 could phenocopy the effect of miR-224 downregulation and silencing of p21WAF1/CIP1 could partially reverse the effect of miR-224 downregulation on DDP resistance of DDP-resistant LA cells. In addition, miR-224 could affect the G1/S transition of cell cycle and apoptosis in LA cells through the p21WAF1/CIP1-pRb pathway and the intrinsic mitochondrial death pathway. Furthermore, miR-224 was found to be downregulated in DDP-responding LA tissues, and its expression was inversely correlated with p21WAF1/CIP1. Multivariate analyses indicated that the status of miR-224 might be an independent prognostic factor for predicting the survival of LA patients. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | [2] | |||
| Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell viability | Inhibition | hsa05200 | |
| DESC1/EGFR/AKT signaling pathway | Regulation | N.A. | ||
| In Vitro Model | KYSE30 cells | Esophagus | Homo sapiens (Human) | CVCL_1351 |
| EC9706 cells | Esophagus | Homo sapiens (Human) | CVCL_E307 | |
| KYSE140 cells | Esophagus | Homo sapiens (Human) | CVCL_1347 | |
| TE13 cells | Esophageal | Homo sapiens (Human) | CVCL_4463 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | TUSC7 suppressed the proliferation and chemotherapy resistance of ESCC cells by increasing DESC1 expression via inhibiting miR-224. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [3] | |||
| Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Wnt/Beta-catenin signaling pathway | Regulation | N.A. | |
| In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
| SW480/ADM cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay; EdU staining | |||
| Mechanism Description | miR224 up-regulation is associated with ADM resistance of CRC cells. Suppression of miR224 expression up-regulated GSk-3beta expression, inhibited Wnt/beta-catenin signal pathway activity and Survivin expression, as well as reduced ADM resistance of CRC SW480 cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | [2] | |||
| Sensitive Disease | Esophageal squamous cell carcinoma [ICD-11: 2B70.3] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell viability | Inhibition | hsa05200 | |
| DESC1/EGFR/AKT signaling pathway | Regulation | N.A. | ||
| In Vitro Model | KYSE30 cells | Esophagus | Homo sapiens (Human) | CVCL_1351 |
| EC9706 cells | Esophagus | Homo sapiens (Human) | CVCL_E307 | |
| KYSE140 cells | Esophagus | Homo sapiens (Human) | CVCL_1347 | |
| TE13 cells | Esophageal | Homo sapiens (Human) | CVCL_4463 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | TUSC7 suppressed the proliferation and chemotherapy resistance of ESCC cells by increasing DESC1 expression via inhibiting miR-224. | |||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [4] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell invasion | Inhibition | hsa05200 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT asssay; Innocyte invasion assay | |||
| Mechanism Description | microRNA-224 was differentially expressed in dysplastic colorectal disease and in isogeneic kRAS WT and mutant HCT116 cells. Antagomir-mediated miR-224 silencing in HCT116 kRAS WT cells phenocopied kRAS mutation, increased kRAS activity and ERk and AkT phosphorylation. 5-FU chemosensitivity was significantly increased in miR-224 knockdown cells, and in NIH3T3 cells expressing kRAS and BRAF mutant proteins. Bioinformatics analysis of predicted miR-224 target genes predicted altered cell proliferation, invasion and epithelial-mesenchymal transition (EMT) phenotypes that were experimentally confirmed in miR-224 knockdown cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [5] | |||
| Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Resistant Drug | Imatinib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTS assay; Flow cytometric analysis; CFU assay | |||
| Mechanism Description | miR224 and let-7i regulate the proliferation and chemosensitivity of CML cells probably via targeting ST3GAL IV. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [6] | |||
| Resistant Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Resistant Drug | Methotrexate | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | The endogenous overexpression of CDS2, DCP2, HSPC159, MYST3 and SLC4A4 in MTX-resistant HT29 cells. Inhibition of miR-224 with anti-miR224 produced an increase in the mRNA levels of CDS2, HSPC159, MYST3 and SLC4A4. Decreased mRNA levels of SLC4A4, CDS2 and HSPC159 cause an increase in MTX sensitivity in HT29 cells. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
