Molecule Information
General Information of the Molecule (ID: Mol01401)
Name |
hsa-mir-218
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 218-1
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR218-1
|
||||
Gene ID | |||||
Location |
chr4:20528275-20528384[+]
|
||||
Sequence |
GUGAUAAUGUAGCGAGAUUUUCUGUUGUGCUUGAUCUAACCAUGUGGUUGCGAGGUAUGA
GUAAAACAUGGUUCCGUCAAGCACCAUGGAACGUCACGCAGCUUUCUACA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Oral cancer | [1] | |||
Resistant Disease | Oral cancer [ICD-11: 2B6E.1] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | PPP2R5A/Wnt signaling pathway | Regulation | hsa04310 | |
In Vitro Model | Tca8113 cells | Tongue | Homo sapiens (Human) | CVCL_6851 |
CAL27 cells | Oral | Homo sapiens (Human) | CVCL_1107 | |
SCC25 cells | Oral | Homo sapiens (Human) | CVCL_1682 | |
SCC9 cells | Tongue | Homo sapiens (Human) | CVCL_1685 | |
MDA-1386Ln cells | Tongue | Homo sapiens (Human) | CVCL_H541 | |
SCC15 cells | Tongue | Homo sapiens (Human) | CVCL_1681 | |
UM1 cells | Tongue | Homo sapiens (Human) | CVCL_VH00 | |
UM2 cells | Tongue | Homo sapiens (Human) | CVCL_VH01 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | microRNA-218 promotes cisplatin resistance in oral cancer via the PPP2R5A/Wnt signaling pathway. Suppression of miR218 or PPP2R5A significantly promoted or reduced cisplatin-induced apoptosis, respectively. PPP2R5A overexpression or beta-catenin knockdown inhibited miR218-mediated Wnt activation and partially restored cell sensitivity. | |||
Disease Class: Prostate cancer | [2] | |||
Resistant Disease | Prostate cancer [ICD-11: 2C82.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell invasion | Activation | hsa05200 | |
Cell migration | Activation | hsa04670 | ||
Cell viability | Activation | hsa05200 | ||
In Vitro Model | DU-145 cells | Prostate | Homo sapiens (Human) | CVCL_0105 |
PC3 cells | Prostate | Homo sapiens (Human) | CVCL_0035 | |
Experiment for Molecule Alteration |
PCR | |||
Experiment for Drug Resistance |
CCK8 assay; Flow cytometric analysis | |||
Mechanism Description | Overexpression of miR218 inhibited cell viability, migration, and invasion in PC3 and DU145 cells. Overexpression of BCAT1 decreased the chemosensitivity to CDDP treatment of PC3 and DU145 cells. The tumor suppressive role of miR218 was mediated by negatively regulating BCAT1 protein expression. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Bladder cancer | [3] | |||
Sensitive Disease | Bladder cancer [ICD-11: 2C94.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | miR218-Glut1 signaling pathway | Regulation | hsa05206 | |
In Vitro Model | EJ cells | Bladder | Homo sapiens (Human) | CVCL_UI82 |
T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | miR218 increases the sensitivity of bladder cancer to cisplatin by targeting Glut1. | |||
Disease Class: Gastric cancer | [4] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
mTOR signaling pathway | Regulation | hsa04150 | ||
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
WST-1 kit assay | |||
Mechanism Description | miR-218 increased chemosensitivity of gastric cancer cells to cisplatin via its target mTOR inhibitor. | |||
Disease Class: Cervical cancer | [5] | |||
Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | AKT/mTOR signaling pathway | Inhibition | hsa04150 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
PCR | |||
Experiment for Drug Resistance |
WST assay | |||
Mechanism Description | Overexpression of miR-218 Inhibited Expression of Rictor, an mTOR Component, and Its Downstream Pathway, inhibited the proliferation of the human cervical cancer cell line HeLa and increased chemosensitivity to cisplatin in vitro by blocking the AkT-mTOR signaling pathway. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [6] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-218 may inhibit efflux of ADM and oxaliplatin by down-regulating P-gp expression. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [7] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell metastasis | Activation | hsa05205 | |
NF-kB signaling pathway | Activation | hsa04218 | ||
In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
Experiment for Molecule Alteration |
qRT-PCR; luciferase reporter assay;ChIP | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | HOTAIR contributes to 5FU resistance through suppressing miR-218 and activating NF-kB signaling in CRC. | |||
Disease Class: Colorectal cancer | [7] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | NF-kB signaling pathway | Activation | hsa04218 | |
In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
FHC cells | Colon | Homo sapiens (Human) | CVCL_3688 | |
Experiment for Molecule Alteration |
qPCR; Western blot analysis | |||
Experiment for Drug Resistance |
CCK8 assay; Colony formation assays | |||
Mechanism Description | LncRNA HOTAIR contributes to 5fu resistance through suppressing miR-218 and activating NF-kB/TS signaling in colorectal cancer. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [6] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-218 may inhibit efflux of ADM and oxaliplatin by down-regulating P-gp expression. | |||
|
||||
Disease Class: Colorectal cancer | [8] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
FHC cells | Colon | Homo sapiens (Human) | CVCL_3688 | |
SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
Boyden chambers cell migration and invasion assays | |||
Mechanism Description | miR218 is a tumor-suppressor gene and could significantly suppress the EMT process, miR218 promoted cell apoptosis and enhanced 5-FU-based chemosensitivity in colorectal cancer cells by targeting BIRC5. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [8] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Leucovorin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
FHC cells | Colon | Homo sapiens (Human) | CVCL_3688 | |
SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
Boyden chambers cell migration and invasion assays | |||
Mechanism Description | miR218 is a tumor-suppressor gene and could significantly suppress the EMT process, miR218 promoted cell apoptosis and enhanced 5-FU-based chemosensitivity in colorectal cancer cells by targeting BIRC5. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colorectal cancer | [9] | |||
Resistant Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Resistant Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
HEK293T cells | Kidney | Homo sapiens (Human) | CVCL_0063 | |
HCT-116/L-OHP cells | Kidney | Homo sapiens (Human) | CVCL_0291 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis of apoptosis | |||
Mechanism Description | Down-regulation of YEATS4 by miR218 sensitizes colorectal cancer cells to L-OHP-induced cell apoptosis by inhibiting cytoprotective autophagy. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Gastric cancer | [6] | |||
Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
Sensitive Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
In Vitro Model | SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR-218 may inhibit efflux of ADM and oxaliplatin by down-regulating P-gp expression. | |||
|
||||
Disease Class: Colorectal cancer | [8] | |||
Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
Sensitive Drug | Oxaliplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
In Vitro Model | HT29 Cells | Colon | Homo sapiens (Human) | CVCL_A8EZ |
SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 | |
FHC cells | Colon | Homo sapiens (Human) | CVCL_3688 | |
SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 | |
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
Boyden chambers cell migration and invasion assays | |||
Mechanism Description | miR218 is a tumor-suppressor gene and could significantly suppress the EMT process, miR218 promoted cell apoptosis and enhanced 5-FU-based chemosensitivity in colorectal cancer cells by targeting BIRC5. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Cervical cancer | [10] | |||
Sensitive Disease | Cervical cancer [ICD-11: 2C77.0] | |||
Sensitive Drug | Sirolimus | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
mTOR signaling pathway | Inhibition | hsa04150 | ||
In Vitro Model | Hela cells | Cervix uteri | Homo sapiens (Human) | CVCL_0030 |
Siha cells | Cervix uteri | Homo sapiens (Human) | CVCL_0032 | |
Caski cells | Uterus | Homo sapiens (Human) | CVCL_1100 | |
C33A cells | Uterus | Homo sapiens (Human) | CVCL_1094 | |
In Vivo Model | Mouse bearing cervical cancer model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | microRNA-218 increases cellular sensitivity to Rapamycin via targeting Rictor and reducing the level of Rictor in cervical cancer. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.