Molecule Information
General Information of the Molecule (ID: Mol01400)
| Name |
hsa-mir-217
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 217
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR217
|
||||
| Gene ID | |||||
| Location |
chr2:55982967-55983076[-]
|
||||
| Sequence |
AGUAUAAUUAUUACAUAGUUUUUGAUGUCGCAGAUACUGCAUCAGGAACUGAUUGGAUAA
GAAUCAGUCACCAUCAGUUCCUAAUGCAUUGCCUUCAGCAUCUAAACAAG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [1] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| PI3K/AKT signaling pathway | Regulation | N.A. | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| SPC-A1 cells | Lung | Homo sapiens (Human) | CVCL_6955 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | miR-217 suppresses tumour development in lung cancer by targeting kRAS and enhances cell sensitivity to cisplatin. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [2] | |||
| Sensitive Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Sensitive Drug | Dasatinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell viability | Inhibition | hsa05200 | ||
| miR217/AGR2 signaling pathway | Regulation | N.A. | ||
| In Vitro Model | K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
| Ku812 cells | Bone marrow | Homo sapiens (Human) | CVCL_0379 | |
| kCL22 cells | Pleural effusion | Homo sapiens (Human) | CVCL_2091 | |
| In Vivo Model | NRG mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | miR-217 sensitizes chronic myelogenous leukemia cells to tyrosine kinase inhibitors by downregulating pro-oncogenic anterior gradient 2. | |||
| Disease Class: Chronic myelogenous Ph(+) leukemia [ICD-11: 2A20.1] | [3] | |||
| Sensitive Disease | Chronic myelogenous Ph(+) leukemia [ICD-11: 2A20.1] | |||
| Sensitive Drug | Dasatinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | Bcr/Abl-expressing k562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
| K562DR cells | Blood | Homo sapiens (Human) | CVCL_4V59 | |
| K562NR cells | Blood | Homo sapiens (Human) | CVCL_4V63 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Forced expression of miR-217 inhibited expression of DNMT3A through a miR-217-binding site within the 3'-untranslated region of DNMT3A and sensitized these cells to growth inhibition mediated by the TkI. long-term exposure of CML k562 cells to ABL TkI such as dasatinib and nilotinib decreased the levels of miR-217 and increased the levels of DNMT1 and DNMT3A, as well as resulting in acquisition of TkI resistance. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Acute myeloid leukemia [ICD-11: 2A60.0] | [4] | |||
| Sensitive Disease | Acute myeloid leukemia [ICD-11: 2A60.0] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | HL60 cells | Peripheral blood | Homo sapiens (Human) | CVCL_0002 |
| K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 | |
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis | |||
| Mechanism Description | microRNA 217 inhibits cell proliferation and enhances chemosensitivity to doxorubicin in acute myeloid leukemia by targeting kRAS. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myelogenous Ph(+) leukemia [ICD-11: 2A20.1] | [3] | |||
| Sensitive Disease | Chronic myelogenous Ph(+) leukemia [ICD-11: 2A20.1] | |||
| Sensitive Drug | Nilotinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | Bcr/Abl-expressing k562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
| K562DR cells | Blood | Homo sapiens (Human) | CVCL_4V59 | |
| K562NR cells | Blood | Homo sapiens (Human) | CVCL_4V63 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Forced expression of miR-217 inhibited expression of DNMT3A through a miR-217-binding site within the 3'-untranslated region of DNMT3A and sensitized these cells to growth inhibition mediated by the TkI. long-term exposure of CML k562 cells to ABL TkI such as dasatinib and nilotinib decreased the levels of miR-217 and increased the levels of DNMT1 and DNMT3A, as well as resulting in acquisition of TkI resistance. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Melanoma [ICD-11: 2C30.0] | [5] | |||
| Sensitive Disease | Melanoma [ICD-11: 2C30.0] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| In Vitro Model | SNU387 cells | Liver | Homo sapiens (Human) | CVCL_0250 |
| Malme3M cells | Skin | Homo sapiens (Human) | CVCL_1438 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Liver cancer [ICD-11: 2C12.6] | [6] | |||
| Resistant Disease | Liver cancer [ICD-11: 2C12.6] | |||
| Resistant Drug | Sorafenib | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell migration | Activation | hsa04670 | |
| Cell proliferation | Activation | hsa05200 | ||
| PI3K/AKT signaling pathway | Activation | hsa04151 | ||
| TGF-beta signaling pathway | Activation | hsa04350 | ||
| In Vitro Model | Huh-7 cells | Liver | Homo sapiens (Human) | CVCL_0336 |
| HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
| HCCLM3 cells | Liver | Homo sapiens (Human) | CVCL_6832 | |
| Hep3B cells | Liver | Homo sapiens (Human) | CVCL_0326 | |
| BEL-7404 cells | Liver | Homo sapiens (Human) | CVCL_6568 | |
| PLC/PRF/5 cells | Liver | Homo sapiens (Human) | CVCL_0485 | |
| SNU449 cells | Liver | Homo sapiens (Human) | CVCL_0454 | |
| Skhep1 cells | Liver | Homo sapiens (Human) | CVCL_0525 | |
| HLE cells | Liver | Homo sapiens (Human) | CVCL_1281 | |
| In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | Overexpression of miR-216a/217 activates the PI3k/Akt and TGF-beta pathways by targeting PTEN and SMAD7, contributing to hepatocarcinogenesis, sorafenib resistance and tumor recurrence in HCC. | |||
Investigative Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Melanoma [ICD-11: 2C30.0] | [5] | |||
| Sensitive Disease | Melanoma [ICD-11: 2C30.0] | |||
| Sensitive Drug | Celastrol | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| In Vitro Model | SNU387 cells | Liver | Homo sapiens (Human) | CVCL_0250 |
| Malme3M cells | Skin | Homo sapiens (Human) | CVCL_1438 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
