Molecule Information

General Information of the Molecule (ID: Mol01400)
Name
hsa-mir-217 ,Homo sapiens
Synonyms
microRNA 217
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR217
Gene ID
406999
Location
chr2:55982967-55983076[-]
Sequence
AGUAUAAUUAUUACAUAGUUUUUGAUGUCGCAGAUACUGCAUCAGGAACUGAUUGGAUAA
GAAUCAGUCACCAUCAGUUCCUAAUGCAUUGCCUUCAGCAUCUAAACAAG
    Click to Show/Hide
Ensembl ID
ENSG00000207548
HGNC ID
HGNC:31594
Precursor Accession
MI0000293
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
7 drug(s) in total
Click to Show/Hide the Full List of Drugs
Carboplatin
Click to Show/Hide
Drug Sensitive Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Carboplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SkOV3 cells Ovary Homo sapiens (Human) CVCL_0532
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 Luciferase report assay; Western blot
Experiment for
Drug Resistance		 Fluorescence microscope assay
Mechanism Description It is interesting to note that this miR targets both VEGF signaling pathways by either directly modulating the VEGFB protein on the neoplastic cells or interfering with the receptor VEGFR2 in the tumor-associated endothelial cells.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [ICD-11: 2C25.5] [2]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
PI3K/AKT signaling pathway Regulation N.A.
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Flow cytometry assay
Mechanism Description miR-217 suppresses tumour development in lung cancer by targeting kRAS and enhances cell sensitivity to cisplatin.
Dasatinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [3]
Sensitive Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
 Disease Info 
Sensitive Drug Dasatinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
miR217/AGR2 signaling pathway Regulation N.A.
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
Ku812 cells Bone marrow Homo sapiens (Human) CVCL_0379
kCL22 cells Pleural effusion Homo sapiens (Human) CVCL_2091
In Vivo Model NRG mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description miR-217 sensitizes chronic myelogenous leukemia cells to tyrosine kinase inhibitors by downregulating pro-oncogenic anterior gradient 2.
Disease Class: Chronic myelogenous Ph(+) leukemia [ICD-11: 2A20.1] [4]
Sensitive Disease Chronic myelogenous Ph(+) leukemia [ICD-11: 2A20.1]
 Disease Info 
Sensitive Drug Dasatinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model Bcr/Abl-expressing k562 cells Blood Homo sapiens (Human) CVCL_0004
K562DR cells Blood Homo sapiens (Human) CVCL_4V59
K562NR cells Blood Homo sapiens (Human) CVCL_4V63
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Forced expression of miR-217 inhibited expression of DNMT3A through a miR-217-binding site within the 3'-untranslated region of DNMT3A and sensitized these cells to growth inhibition mediated by the TkI. long-term exposure of CML k562 cells to ABL TkI such as dasatinib and nilotinib decreased the levels of miR-217 and increased the levels of DNMT1 and DNMT3A, as well as resulting in acquisition of TkI resistance.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Acute myeloid leukemia [ICD-11: 2A60.0] [5]
Sensitive Disease Acute myeloid leukemia [ICD-11: 2A60.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
K562 cells Blood Homo sapiens (Human) CVCL_0004
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometric analysis
Mechanism Description microRNA 217 inhibits cell proliferation and enhances chemosensitivity to doxorubicin in acute myeloid leukemia by targeting kRAS.
Nilotinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myelogenous Ph(+) leukemia [ICD-11: 2A20.1] [4]
Sensitive Disease Chronic myelogenous Ph(+) leukemia [ICD-11: 2A20.1]
 Disease Info 
Sensitive Drug Nilotinib
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model Bcr/Abl-expressing k562 cells Blood Homo sapiens (Human) CVCL_0004
K562DR cells Blood Homo sapiens (Human) CVCL_4V59
K562NR cells Blood Homo sapiens (Human) CVCL_4V63
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Forced expression of miR-217 inhibited expression of DNMT3A through a miR-217-binding site within the 3'-untranslated region of DNMT3A and sensitized these cells to growth inhibition mediated by the TkI. long-term exposure of CML k562 cells to ABL TkI such as dasatinib and nilotinib decreased the levels of miR-217 and increased the levels of DNMT1 and DNMT3A, as well as resulting in acquisition of TkI resistance.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [6]
Sensitive Disease Melanoma [ICD-11: 2C30.0]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model SNU387 cells Liver Homo sapiens (Human) CVCL_0250
Malme3M cells Skin Homo sapiens (Human) CVCL_1438
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics.
Sorafenib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Liver cancer [ICD-11: 2C12.6] [7]
Resistant Disease Liver cancer [ICD-11: 2C12.6]
 Disease Info 
Resistant Drug Sorafenib
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
PI3K/AKT signaling pathway Activation hsa04151
TGF-beta signaling pathway Activation hsa04350
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
HCCLM3 cells Liver Homo sapiens (Human) CVCL_6832
Hep3B cells Liver Homo sapiens (Human) CVCL_0326
BEL-7404 cells Liver Homo sapiens (Human) CVCL_6568
PLC/PRF/5 cells Liver Homo sapiens (Human) CVCL_0485
SNU449 cells Liver Homo sapiens (Human) CVCL_0454
Skhep1 cells Liver Homo sapiens (Human) CVCL_0525
HLE cells Liver Homo sapiens (Human) CVCL_1281
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description Overexpression of miR-216a/217 activates the PI3k/Akt and TGF-beta pathways by targeting PTEN and SMAD7, contributing to hepatocarcinogenesis, sorafenib resistance and tumor recurrence in HCC.
Investigative Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Celastrol
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Melanoma [ICD-11: 2C30.0] [6]
Sensitive Disease Melanoma [ICD-11: 2C30.0]
 Disease Info 
Sensitive Drug Celastrol
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
In Vitro Model SNU387 cells Liver Homo sapiens (Human) CVCL_0250
Malme3M cells Skin Homo sapiens (Human) CVCL_1438
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics.
References
Ref 1 VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
Ref 2 MicroRNA-217 functions as a tumour suppressor gene and correlates with cell resistance to cisplatin in lung cancer. Mol Cells. 2014 Sep;37(9):664-71. doi: 10.14348/molcells.2014.0121. Epub 2014 Sep 18.
Ref 3 miR-217 sensitizes chronic myelogenous leukemia cells to tyrosine kinase inhibitors by targeting pro-oncogenic anterior gradient 2. Exp Hematol. 2018 Dec;68:80-88.e2. doi: 10.1016/j.exphem.2018.09.001. Epub 2018 Sep 5.
Ref 4 Downregulation of miR-217 correlates with resistance of Ph(+) leukemia cells to ABL tyrosine kinase inhibitors. Cancer Sci. 2014 Mar;105(3):297-307. doi: 10.1111/cas.12339. Epub 2014 Jan 30.
Ref 5 MicroRNA 217 inhibits cell proliferation and enhances chemosensitivity to doxorubicin in acute myeloid leukemia by targeting KRAS. Oncol Lett. 2017 Jun;13(6):4986-4994. doi: 10.3892/ol.2017.6076. Epub 2017 Apr 24.
Ref 6 miR-326-histone deacetylase-3 feedback loop regulates the invasion and tumorigenic and angiogenic response to anti-cancer drugs. J Biol Chem. 2014 Oct 3;289(40):28019-39. doi: 10.1074/jbc.M114.578229. Epub 2014 Aug 19.
Ref 7 MicroRNA-216a/217-induced epithelial-mesenchymal transition targets PTEN and SMAD7 to promote drug resistance and recurrence of liver cancer. Hepatology. 2013 Aug;58(2):629-41. doi: 10.1002/hep.26369. Epub 2013 Jun 25.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.