Molecule Information

General Information of the Molecule (ID: Mol01396)

• Name: hsa-mir-212 ,Homo sapiens
• Synonyms: microRNA 212
• Molecule Type: Precursor miRNA
• Gene Name: MIR212
• Gene ID: 406994
• Location: chr17:2050271-2050380[-]
• Sequence:
  CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGG
  CCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC
• Ensembl ID: ENSG00000267195
• HGNC ID: HGNC:31589
• Precursor Accession: MI0000288

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cetuximab

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.1] [1]

• Resistant Disease: Head and neck squamous cell carcinoma [ICD-11: 2D42.1]
• Resistant Drug: Cetuximab
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: SCC1 cells; Tongue; Homo sapiens (Human); CVCL_A5SA
• In Vitro Model: 1Cc8 cells; Epithelium; Homo sapiens (Human); CVCL_L893
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: HB-EGF can induce EMT, enhance metastasis, and modulate chemotherapy resistance. Increased expression of HB-EGF due to down-regulation of miR-212 is a possible mechanism of cetuximab resistance.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] [2]

• Resistant Disease: Lung adenocarcinoma [ICD-11: 2C25.0]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Clonogenic assay
• Mechanism Description: Six miRNAs (miR-192, 200b, 194, 424, 98 and 212) exhibited more than 2-fold changes in their expression levels, which were validated by qRT-PCR. The expression of three miRNAs (miR-200b, 194 and 212) was significantly down-regulated in SPC-A1/docetaxel cells, while the expression of other three miRNAs (miR-192, 424 and 98) was significantly up-regulated in SPC-A1/docetaxel cells (P < 0.01).

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• Cell Pathway Regulation: PTEN/AKT/NF-kappaB signaling pathway; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: AkT/NF-kB pathway contributes to the miR-132/-212-mediated drug resistance phenotype in breast cancer cells, which is likely regulated by suppressing PTEN expression at the molecular level.

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [4]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Caspase-3 activity assay
• Mechanism Description: Duplicate experiments demonstrated that 15 miRNAs had a >2-fold increase in expression in MYL-R cells relative to MYL cells and that 15 miRNAs showed a >2-fold decrease in relative expression.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [5]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Huh7 cells; Kidney; Homo sapiens (Human); CVCL_U442
• In Vitro Model: HCCLM3 cells; Liver; Homo sapiens (Human); CVCL_6832
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: The results showed that treatment of HCC cells with PTX inhibited cell viability and miR-212-3p level. Moreover, miR-212-3p was reduced and its overexpression resulted in decreased cell viability, half maximal inhibitory concentration (IC50) of PTX and levels of P-glycoprotein and glutathione S-transferase pi, but increased cell apoptosis, in Huh7/PTX cells. However, miR-212-3p knockdown induced opposite effects in Huh7 cells. Furthermore, EMT, migration and invasion were induced in Huh7/PTX cells and the addition of miR-212-3p inhibited EMT, migration and invasion. Meanwhile, miR-212-3p abrogation caused the opposite effects in Huh7 cells. Additionally, ZEB2 was directly targeted by miR-212-3p and its restoration or silencing abated the effect of miR-221-3p overexpression or knockdown in Huh7/PTX or Huh7 cells, respectively. The data from the present study suggest that miR-212-3p attenuates PTX resistance, by regulating EMT, migration and invasion via targeting ZEB2 in HCC cells, indicating a novel target for HCC chemotherapy.

References

• Ref 1: Regulation of heparin-binding EGF-like growth factor by miR-212 and acquired cetuximab-resistance in head and neck squamous cell carcinoma. PLoS One. 2010 Sep 13;5(9):e12702. doi: 10.1371/journal.pone.0012702.
• Ref 2: Identification of microRNA profiles in docetaxel-resistant human non-small cell lung carcinoma cells (SPC-A1). J Cell Mol Med. 2010 Jan;14(1-2):206-14. doi: 10.1111/j.1582-4934.2009.00964.x. Epub 2009 Nov 9.
• Ref 3: MicroRNA-132 and microRNA-212 mediate doxorubicin resistance by down-regulating the PTEN-AKT/NF-kB signaling pathway in breast cancer. Biomed Pharmacother. 2018 Jun;102:286-294. doi: 10.1016/j.biopha.2018.03.088. Epub 2018 Mar 22.
• Ref 4: MiR-34a attenuates paclitaxel-resistance of hormone-refractory prostate cancer PC3 cells through direct and indirect mechanisms. Prostate. 2010 Oct 1;70(14):1501-12. doi: 10.1002/pros.21185.
• Ref 5: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.