Molecule Information
General Information of the Molecule (ID: Mol01396)
| Name |
hsa-mir-212
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 212
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR212
|
||||
| Gene ID | |||||
| Location |
chr17:2050271-2050380[-]
|
||||
| Sequence |
CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGG
CCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Head and neck squamous cell carcinoma [ICD-11: 2D42.1] | [1] | |||
| Resistant Disease | Head and neck squamous cell carcinoma [ICD-11: 2D42.1] | |||
| Resistant Drug | Cetuximab | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | SCC1 cells | Tongue | Homo sapiens (Human) | CVCL_A5SA |
| 1Cc8 cells | Epithelium | Homo sapiens (Human) | CVCL_L893 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | HB-EGF can induce EMT, enhance metastasis, and modulate chemotherapy resistance. Increased expression of HB-EGF due to down-regulation of miR-212 is a possible mechanism of cetuximab resistance. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] | [2] | |||
| Resistant Disease | Lung adenocarcinoma [ICD-11: 2C25.0] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SPC-A1 cells | Lung | Homo sapiens (Human) | CVCL_6955 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Clonogenic assay | |||
| Mechanism Description | Six miRNAs (miR-192, 200b, 194, 424, 98 and 212) exhibited more than 2-fold changes in their expression levels, which were validated by qRT-PCR. The expression of three miRNAs (miR-200b, 194 and 212) was significantly down-regulated in SPC-A1/docetaxel cells, while the expression of other three miRNAs (miR-192, 424 and 98) was significantly up-regulated in SPC-A1/docetaxel cells (P < 0.01). | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [3] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Cell viability | Activation | hsa05200 | ||
| PTEN/AKT/NF-kappaB signaling pathway | Regulation | N.A. | ||
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | AkT/NF-kB pathway contributes to the miR-132/-212-mediated drug resistance phenotype in breast cancer cells, which is likely regulated by suppressing PTEN expression at the molecular level. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] | [4] | |||
| Resistant Disease | Chronic myeloid leukemia [ICD-11: 2A20.0] | |||
| Resistant Drug | Imatinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Caspase-3 activity assay | |||
| Mechanism Description | Duplicate experiments demonstrated that 15 miRNAs had a >2-fold increase in expression in MYL-R cells relative to MYL cells and that 15 miRNAs showed a >2-fold decrease in relative expression. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] | [5] | |||
| Sensitive Disease | Hepatocellular carcinoma [ICD-11: 2C12.0] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | Huh7 cells | Kidney | Homo sapiens (Human) | CVCL_U442 |
| HCCLM3 cells | Liver | Homo sapiens (Human) | CVCL_6832 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
| Mechanism Description | The results showed that treatment of HCC cells with PTX inhibited cell viability and miR-212-3p level. Moreover, miR-212-3p was reduced and its overexpression resulted in decreased cell viability, half maximal inhibitory concentration (IC50) of PTX and levels of P-glycoprotein and glutathione S-transferase pi, but increased cell apoptosis, in Huh7/PTX cells. However, miR-212-3p knockdown induced opposite effects in Huh7 cells. Furthermore, EMT, migration and invasion were induced in Huh7/PTX cells and the addition of miR-212-3p inhibited EMT, migration and invasion. Meanwhile, miR-212-3p abrogation caused the opposite effects in Huh7 cells. Additionally, ZEB2 was directly targeted by miR-212-3p and its restoration or silencing abated the effect of miR-221-3p overexpression or knockdown in Huh7/PTX or Huh7 cells, respectively. The data from the present study suggest that miR-212-3p attenuates PTX resistance, by regulating EMT, migration and invasion via targeting ZEB2 in HCC cells, indicating a novel target for HCC chemotherapy. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
