General Information of the Molecule (ID: Mol01396)
Name
hsa-mir-212 ,Homo sapiens
Synonyms
microRNA 212
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR212
Gene ID
406994
Location
chr17:2050271-2050380[-]
Sequence
CGGGGCACCCCGCCCGGACAGCGCGCCGGCACCUUGGCUCUAGACUGCUUACUGCCCGGG
CCGCCCUCAGUAACAGUCUCCAGUCACGGCCACCGACGCCUGGCCCCGCC
    Click to Show/Hide
Ensembl ID
ENSG00000267195
HGNC ID
HGNC:31589
Precursor Accession
MI0000288
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cetuximab
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Head and neck squamous cell carcinoma [1]
Resistant Disease Head and neck squamous cell carcinoma [ICD-11: 2D42.1]
Resistant Drug Cetuximab
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model SCC1 cells Tongue Homo sapiens (Human) CVCL_A5SA
1Cc8 cells Epithelium Homo sapiens (Human) CVCL_L893
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description HB-EGF can induce EMT, enhance metastasis, and modulate chemotherapy resistance. Increased expression of HB-EGF due to down-regulation of miR-212 is a possible mechanism of cetuximab resistance.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung adenocarcinoma [2]
Resistant Disease Lung adenocarcinoma [ICD-11: 2C25.0]
Resistant Drug Docetaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Clonogenic assay
Mechanism Description Six miRNAs (miR-192, 200b, 194, 424, 98 and 212) exhibited more than 2-fold changes in their expression levels, which were validated by qRT-PCR. The expression of three miRNAs (miR-200b, 194 and 212) was significantly down-regulated in SPC-A1/docetaxel cells, while the expression of other three miRNAs (miR-192, 424 and 98) was significantly up-regulated in SPC-A1/docetaxel cells (P < 0.01).
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [3]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
PTEN/AKT/NF-kappaB signaling pathway Regulation hsa05235
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description AkT/NF-kB pathway contributes to the miR-132/-212-mediated drug resistance phenotype in breast cancer cells, which is likely regulated by suppressing PTEN expression at the molecular level.
References
Ref 1 Regulation of heparin-binding EGF-like growth factor by miR-212 and acquired cetuximab-resistance in head and neck squamous cell carcinoma. PLoS One. 2010 Sep 13;5(9):e12702. doi: 10.1371/journal.pone.0012702.
Ref 2 Identification of microRNA profiles in docetaxel-resistant human non-small cell lung carcinoma cells (SPC-A1). J Cell Mol Med. 2010 Jan;14(1-2):206-14. doi: 10.1111/j.1582-4934.2009.00964.x. Epub 2009 Nov 9.
Ref 3 MicroRNA-132 and microRNA-212 mediate doxorubicin resistance by down-regulating the PTEN-AKT/NF-kB signaling pathway in breast cancer. Biomed Pharmacother. 2018 Jun;102:286-294. doi: 10.1016/j.biopha.2018.03.088. Epub 2018 Mar 22.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.