Molecule Information

General Information of the Molecule (ID: Mol01395)

• Name: hsa-mir-211 ,Homo sapiens
• Synonyms: microRNA 211
• Molecule Type: Precursor miRNA
• Gene Name: MIR211
• Gene ID: 406993
• Location: chr15:31065032-31065141[-]
• Sequence:
  UCACCUGGCCAUGUGACUUGUGGGCUUCCCUUUGUCAUCCUUCGCCUAGGGCUCUGAGCA
  GGGCAGGGACAGCAAAGGGGUGCUCAGUUGUCACUUCCCACAGCACGGAG
• Ensembl ID: ENSG00000207702
• HGNC ID: HGNC:31588
• Precursor Accession: MI0000287

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [ICD-11: 2C30.0] [1]

• Resistant Disease: Melanoma [ICD-11: 2C30.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Methylation; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: A375 cells; Skin; Homo sapiens (Human); CVCL_0132
• In Vitro Model: Sk-Mel28 cells; Skin; Homo sapiens (Human); CVCL_0526
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Overexpressed 211 could enhance the anticancer effect of cisplatin and restoration of miR-211 rendered susceptibility to cisplatin in cisplatin-resistant cells.miR-211 could be transcriptionally repressed by EZH2 mediated promoter methylation.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [2]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vitro Model: SNU-739 cells; Liver; Homo sapiens (Human); CVCL_5088
• In Vitro Model: 769-P cells; Kidney; Homo sapiens (Human); CVCL_1050
• In Vitro Model: 786-O cells; Kidney; Homo sapiens (Human); CVCL_1051
• In Vivo Model: Immunodeficient mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Luciferase assay
• Experiment for Drug Resistance: Cell cycle analysis; Apoptosis analysis
• Mechanism Description: This gene is down-regulated in doxorubicin-sensitive cells

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [2]

• Sensitive Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hela cells; Cervix uteri; Homo sapiens (Human); CVCL_0030
• In Vitro Model: SNU182 cells; Liver; Homo sapiens (Human); CVCL_0090
• In Vitro Model: SNU-739 cells; Liver; Homo sapiens (Human); CVCL_5088
• In Vitro Model: 769-P cells; Kidney; Homo sapiens (Human); CVCL_1050
• In Vitro Model: 786-O cells; Kidney; Homo sapiens (Human); CVCL_1051
• In Vivo Model: Immunodeficient mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Luciferase assay
• Experiment for Drug Resistance: Cell cycle analysis; Apoptosis analysis
• Mechanism Description: This gene is down-regulated in doxorubicin-sensitive cells

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [ICD-11: 2C60.3] [3]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Epithelial mesenchymal transition signaling pathway; Inhibition; hsa01521
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• In Vitro Model: ZR75-1 cells; Breast; Homo sapiens (Human); CVCL_0588
• In Vitro Model: MCF10A cells; Breast; Homo sapiens (Human); CVCL_0598
• In Vivo Model: Mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Transwell migration assay
• Mechanism Description: NEAT1 promoted invasion through inducing Epithelial-mesenchymal transition (EMT), NEAT1 down-regulation inhibited cell motility and invasion by reversing the EMT phenotype and increased breast cancer cells chemo-sensitivity. There may be a reciprocal repression between miR211 and NEAT1.

Gemcitabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [4]

• Sensitive Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Sensitive Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: Suit2 cells; Pancreas; Homo sapiens (Human); CVCL_3172
• In Vitro Model: SUIT2-007 cells; Pancreas; Homo sapiens (Human); CVCL_B279
• In Vitro Model: SUIT2-028 cells; Pancreas; Homo sapiens (Human); CVCL_B282
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Transwell assay
• Mechanism Description: The induction of the miR-211 expression in the cells increased the sensitivity to gemcitabine and reduced the expression of its target ribonucleotide reductase subunit 2 (RRM2).

Temozolomide

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [5]

• Sensitive Disease: Neuroblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Intrinsic mitochondrial/Caspase-9/3-mediated apoptotic pathway; Regulation; N.A.
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• In Vivo Model: Glioblastoma patient tumour model; Homo sapiens
• Experiment for Molecule Alteration: Immunoblotting; RT-PCR; Immunohistochemistry
• Experiment for Drug Resistance: Fluorescence-activated; TUNEL assay; Apoptotic DNA fragmentation analysis
• Mechanism Description: Furthermore, we found that miR-211 suppression in GBM involves aberrant methylation-mediated epigenetic silencing of the miR-211 promoter. Indeed, we observed a highly significant inverse correlation between miR-211 expression and MMP-9 protein levels, which is indicative of post-transcriptional control of gene expression. Additionally, shRNA specific for MMP-9 (pM) promoted miR-211 expression via demethylation of miR-211 promoter-associated CpG islands (-140 to +56). In independent experiments, we confirmed that miR-211 overexpression and pM treatments led to the activation of the intrinsic mitochondrial/Caspase-9/3-mediated apoptotic pathway in both glioma cells and cancer stem cells (CSC). We also investigated whether miR-211 is involved in the regulation of MMP-9 and thus plays a functional role in GBM. We found an acute inhibitory effect of miR-211 on glioma cell invasion and migration via suppression of MMP-9. Given the insensitivity of some GBMs to radiation and chemotherapy (temozolomide) along with the hypothesis that glioma CSC cause resistance to therapy, our study indicates that miR-211 or pM in combination with ionizing radiation (IR) and temozolomide significantly induces apoptosis and DNA fragmentation.

References

• Ref 1: Methylation-Mediated Silencing of MicroRNA-211 Decreases the Sensitivity of Melanoma Cells to Cisplatin. Med Sci Monit. 2019 Mar 1;25:1590-1599. doi: 10.12659/MSM.911862.
• Ref 2: The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
• Ref 3: The lncRNA NEAT1 facilitates cell growth and invasion via the miR-211/HMGA2 axis in breast cancer. Int J Biol Macromol. 2017 Dec;105(Pt 1):346-353. doi: 10.1016/j.ijbiomac.2017.07.053. Epub 2017 Jul 16.
• Ref 4: miR-211 modulates gemcitabine activity through downregulation of ribonucleotide reductase and inhibits the invasive behavior of pancreatic cancer cells. Nucleosides Nucleotides Nucleic Acids. 2014;33(4-6):384-93. doi: 10.1080/15257770.2014.891741.
• Ref 5: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.