Molecule Information
General Information of the Molecule (ID: Mol01389)
| Name |
hsa-mir-187
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 187
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR187
|
||||
| Gene ID | |||||
| Location |
chr18:35904818-35904926[-]
|
||||
| Sequence |
GGUCGGGCUCACCAUGACACAGUGUGAGACCUCGGGCUACAACACAGGACCCGGGCGCUG
CUCUGACCCCUCGUGUCUUGUGUUGCAGCCGGAGGGACGCAGGUCCGCA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Peripheral T-cell lymphoma [ICD-11: 2A90.0] | [2] | |||
| Sensitive Disease | Peripheral T-cell lymphoma [ICD-11: 2A90.0] | |||
| Sensitive Drug | Bortezomib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
| In Vitro Model | MOLT4 cells | Bone marrow | Homo sapiens (Human) | CVCL_0013 |
| HUT78 cells | Lymph | Homo sapiens (Human) | CVCL_0337 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR187 downregulated tumor suppressor gene disabled homolog-2 (Dab2), decreased the interaction of Dab2 with adapter protein Grb2, resulting in Ras activation, phosphorylation/activation of extracellular signal-regulated kinase (ERk) and AkT, and subsequent stabilization of MYC oncoprotein. MiR187-overexpressing cells were resistant to chemotherapeutic agents like doxorubicin, cyclophosphamide, cisplatin and gemcitabine, but sensitive to the proteasome inhibitor bortezomib. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Peripheral T-cell lymphoma [ICD-11: 2A90.0] | [2] | |||
| Resistant Disease | Peripheral T-cell lymphoma [ICD-11: 2A90.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | MOLT4 cells | Bone marrow | Homo sapiens (Human) | CVCL_0013 |
| HUT78 cells | Lymph | Homo sapiens (Human) | CVCL_0337 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR187 downregulated tumor suppressor gene disabled homolog-2 (Dab2), decreased the interaction of Dab2 with adapter protein Grb2, resulting in Ras activation, phosphorylation/activation of extracellular signal-regulated kinase (ERk) and AkT, and subsequent stabilization of MYC oncoprotein. MiR187-overexpressing cells were resistant to chemotherapeutic agents like doxorubicin, cyclophosphamide, cisplatin and gemcitabine, but sensitive to the proteasome inhibitor bortezomib. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Esophageal adenocarcinoma [ICD-11: 2B70.2] | [3] | |||
| Sensitive Disease | Esophageal adenocarcinoma [ICD-11: 2B70.2] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | OE33 cellss | Esophagus | Homo sapiens (Human) | CVCL_0471 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | PTEN and TNF were demonstrated to be upregulated following miR-187 overexpression. TNF is a cytokine that regulates multiple cellular processes including proliferation and apoptosis. PTEN acts as a tumor suppressor and regulates the PI3k/AkT pathway, which has been identified as a radiation response pathway. The upregulation of PTEN enhances radiosensitivity via the downregulation of the PI3k/AkT pathway. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Peripheral T-cell lymphoma [ICD-11: 2A90.0] | [2] | |||
| Resistant Disease | Peripheral T-cell lymphoma [ICD-11: 2A90.0] | |||
| Resistant Drug | Cyclophosphamide | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | MOLT4 cells | Bone marrow | Homo sapiens (Human) | CVCL_0013 |
| HUT78 cells | Lymph | Homo sapiens (Human) | CVCL_0337 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR187 downregulated tumor suppressor gene disabled homolog-2 (Dab2), decreased the interaction of Dab2 with adapter protein Grb2, resulting in Ras activation, phosphorylation/activation of extracellular signal-regulated kinase (ERk) and AkT, and subsequent stabilization of MYC oncoprotein. MiR187-overexpressing cells were resistant to chemotherapeutic agents like doxorubicin, cyclophosphamide, cisplatin and gemcitabine, but sensitive to the proteasome inhibitor bortezomib. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Peripheral T-cell lymphoma [ICD-11: 2A90.0] | [2] | |||
| Resistant Disease | Peripheral T-cell lymphoma [ICD-11: 2A90.0] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | MOLT4 cells | Bone marrow | Homo sapiens (Human) | CVCL_0013 |
| HUT78 cells | Lymph | Homo sapiens (Human) | CVCL_0337 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR187 downregulated tumor suppressor gene disabled homolog-2 (Dab2), decreased the interaction of Dab2 with adapter protein Grb2, resulting in Ras activation, phosphorylation/activation of extracellular signal-regulated kinase (ERk) and AkT, and subsequent stabilization of MYC oncoprotein. MiR187-overexpressing cells were resistant to chemotherapeutic agents like doxorubicin, cyclophosphamide, cisplatin and gemcitabine, but sensitive to the proteasome inhibitor bortezomib. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.2] | [4] | |||
| Resistant Disease | Breast cancer [ICD-11: 2C60.2] | |||
| Resistant Drug | Etoposide | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | MRP-1/ABCC1 | Regulation | N.A. | |
| In Vitro Model | MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| MCF-7 cells | Breast | Homo sapiens (Human) | CVCL_0031 | |
| Experiment for Molecule Alteration |
RT-PCR; qRT-PCR; Luciferase reporter assay; Western blot; Immunofluorescence staining | |||
| Experiment for Drug Resistance |
MTS assay | |||
| Mechanism Description | Seventeen of miRNAs were differentially expressed in MCF-7/VP cells and their parent cells. The majority of these miRNAs exhibited increased expression levels, while miR-326, miR-429, miR-187, miR-7, and miR-92-2 showed decreased expression. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Peripheral T-cell lymphoma [ICD-11: 2A90.0] | [2] | |||
| Resistant Disease | Peripheral T-cell lymphoma [ICD-11: 2A90.0] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
| In Vitro Model | MOLT4 cells | Bone marrow | Homo sapiens (Human) | CVCL_0013 |
| HUT78 cells | Lymph | Homo sapiens (Human) | CVCL_0337 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR187 downregulated tumor suppressor gene disabled homolog-2 (Dab2), decreased the interaction of Dab2 with adapter protein Grb2, resulting in Ras activation, phosphorylation/activation of extracellular signal-regulated kinase (ERk) and AkT, and subsequent stabilization of MYC oncoprotein. MiR187-overexpressing cells were resistant to chemotherapeutic agents like doxorubicin, cyclophosphamide, cisplatin and gemcitabine, but sensitive to the proteasome inhibitor bortezomib. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
