Molecule Information

General Information of the Molecule (ID: Mol01389)

• Name: hsa-mir-187 ,Homo sapiens
• Synonyms: microRNA 187
• Molecule Type: Precursor miRNA
• Gene Name: MIR187
• Gene ID: 406963
• Location: chr18:35904818-35904926[-]
• Sequence:
  GGUCGGGCUCACCAUGACACAGUGUGAGACCUCGGGCUACAACACAGGACCCGGGCGCUG
  CUCUGACCCCUCGUGUCUUGUGUUGCAGCCGGAGGGACGCAGGUCCGCA
• Ensembl ID: ENSG00000207797
• HGNC ID: HGNC:31558
• Precursor Accession: MI0000274

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Bortezomib

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Peripheral T-cell lymphoma [1]

• Sensitive Disease: Peripheral T-cell lymphoma [ICD-11: 2A90.0]
• Sensitive Drug: Bortezomib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: MOLT4 cells; Bone marrow; Homo sapiens (Human); CVCL_0013
• In Vitro Model: HUT78 cells; Lymph; Homo sapiens (Human); CVCL_0337
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR187 downregulated tumor suppressor gene disabled homolog-2 (Dab2), decreased the interaction of Dab2 with adapter protein Grb2, resulting in Ras activation, phosphorylation/activation of extracellular signal-regulated kinase (ERk) and AkT, and subsequent stabilization of MYC oncoprotein. MiR187-overexpressing cells were resistant to chemotherapeutic agents like doxorubicin, cyclophosphamide, cisplatin and gemcitabine, but sensitive to the proteasome inhibitor bortezomib.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Peripheral T-cell lymphoma [1]

• Resistant Disease: Peripheral T-cell lymphoma [ICD-11: 2A90.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MOLT4 cells; Bone marrow; Homo sapiens (Human); CVCL_0013
• In Vitro Model: HUT78 cells; Lymph; Homo sapiens (Human); CVCL_0337
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR187 downregulated tumor suppressor gene disabled homolog-2 (Dab2), decreased the interaction of Dab2 with adapter protein Grb2, resulting in Ras activation, phosphorylation/activation of extracellular signal-regulated kinase (ERk) and AkT, and subsequent stabilization of MYC oncoprotein. MiR187-overexpressing cells were resistant to chemotherapeutic agents like doxorubicin, cyclophosphamide, cisplatin and gemcitabine, but sensitive to the proteasome inhibitor bortezomib.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Esophageal adenocarcinoma [2]

• Sensitive Disease: Esophageal adenocarcinoma [ICD-11: 2B70.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• In Vitro Model: OE33 cellss; Esophagus; Homo sapiens (Human); CVCL_0471
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: PTEN and TNF were demonstrated to be upregulated following miR-187 overexpression. TNF is a cytokine that regulates multiple cellular processes including proliferation and apoptosis. PTEN acts as a tumor suppressor and regulates the PI3k/AkT pathway, which has been identified as a radiation response pathway. The upregulation of PTEN enhances radiosensitivity via the downregulation of the PI3k/AkT pathway.

Cyclophosphamide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Peripheral T-cell lymphoma [1]

• Resistant Disease: Peripheral T-cell lymphoma [ICD-11: 2A90.0]
• Resistant Drug: Cyclophosphamide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MOLT4 cells; Bone marrow; Homo sapiens (Human); CVCL_0013
• In Vitro Model: HUT78 cells; Lymph; Homo sapiens (Human); CVCL_0337
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR187 downregulated tumor suppressor gene disabled homolog-2 (Dab2), decreased the interaction of Dab2 with adapter protein Grb2, resulting in Ras activation, phosphorylation/activation of extracellular signal-regulated kinase (ERk) and AkT, and subsequent stabilization of MYC oncoprotein. MiR187-overexpressing cells were resistant to chemotherapeutic agents like doxorubicin, cyclophosphamide, cisplatin and gemcitabine, but sensitive to the proteasome inhibitor bortezomib.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Peripheral T-cell lymphoma [1]

• Resistant Disease: Peripheral T-cell lymphoma [ICD-11: 2A90.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MOLT4 cells; Bone marrow; Homo sapiens (Human); CVCL_0013
• In Vitro Model: HUT78 cells; Lymph; Homo sapiens (Human); CVCL_0337
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR187 downregulated tumor suppressor gene disabled homolog-2 (Dab2), decreased the interaction of Dab2 with adapter protein Grb2, resulting in Ras activation, phosphorylation/activation of extracellular signal-regulated kinase (ERk) and AkT, and subsequent stabilization of MYC oncoprotein. MiR187-overexpressing cells were resistant to chemotherapeutic agents like doxorubicin, cyclophosphamide, cisplatin and gemcitabine, but sensitive to the proteasome inhibitor bortezomib.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Peripheral T-cell lymphoma [1]

• Resistant Disease: Peripheral T-cell lymphoma [ICD-11: 2A90.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: MOLT4 cells; Bone marrow; Homo sapiens (Human); CVCL_0013
• In Vitro Model: HUT78 cells; Lymph; Homo sapiens (Human); CVCL_0337
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR187 downregulated tumor suppressor gene disabled homolog-2 (Dab2), decreased the interaction of Dab2 with adapter protein Grb2, resulting in Ras activation, phosphorylation/activation of extracellular signal-regulated kinase (ERk) and AkT, and subsequent stabilization of MYC oncoprotein. MiR187-overexpressing cells were resistant to chemotherapeutic agents like doxorubicin, cyclophosphamide, cisplatin and gemcitabine, but sensitive to the proteasome inhibitor bortezomib.

References

• Ref 1: MicroRNA187 overexpression is related to tumor progression and determines sensitivity to bortezomib in peripheral T-cell lymphoma. Leukemia. 2014 Apr;28(4):880-7. doi: 10.1038/leu.2013.291. Epub 2013 Oct 9.
• Ref 2: Low miR-187 expression promotes resistance to chemoradiation therapy in vitro and correlates with treatment failure in patients with esophageal adenocarcinoma. Mol Med. 2016 May 23;22:388-97. doi: 10.2119/molmed.2016.00020.