Molecule Information
General Information of the Molecule (ID: Mol01389)
Name |
hsa-mir-187
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 187
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR187
|
||||
Gene ID | |||||
Location |
chr18:35904818-35904926[-]
|
||||
Sequence |
GGUCGGGCUCACCAUGACACAGUGUGAGACCUCGGGCUACAACACAGGACCCGGGCGCUG
CUCUGACCCCUCGUGUCUUGUGUUGCAGCCGGAGGGACGCAGGUCCGCA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Peripheral T-cell lymphoma | [1] | |||
Sensitive Disease | Peripheral T-cell lymphoma [ICD-11: 2A90.0] | |||
Sensitive Drug | Bortezomib | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
In Vitro Model | MOLT4 cells | Bone marrow | Homo sapiens (Human) | CVCL_0013 |
HUT78 cells | Lymph | Homo sapiens (Human) | CVCL_0337 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR187 downregulated tumor suppressor gene disabled homolog-2 (Dab2), decreased the interaction of Dab2 with adapter protein Grb2, resulting in Ras activation, phosphorylation/activation of extracellular signal-regulated kinase (ERk) and AkT, and subsequent stabilization of MYC oncoprotein. MiR187-overexpressing cells were resistant to chemotherapeutic agents like doxorubicin, cyclophosphamide, cisplatin and gemcitabine, but sensitive to the proteasome inhibitor bortezomib. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Peripheral T-cell lymphoma | [1] | |||
Resistant Disease | Peripheral T-cell lymphoma [ICD-11: 2A90.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
In Vitro Model | MOLT4 cells | Bone marrow | Homo sapiens (Human) | CVCL_0013 |
HUT78 cells | Lymph | Homo sapiens (Human) | CVCL_0337 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR187 downregulated tumor suppressor gene disabled homolog-2 (Dab2), decreased the interaction of Dab2 with adapter protein Grb2, resulting in Ras activation, phosphorylation/activation of extracellular signal-regulated kinase (ERk) and AkT, and subsequent stabilization of MYC oncoprotein. MiR187-overexpressing cells were resistant to chemotherapeutic agents like doxorubicin, cyclophosphamide, cisplatin and gemcitabine, but sensitive to the proteasome inhibitor bortezomib. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Esophageal adenocarcinoma | [2] | |||
Sensitive Disease | Esophageal adenocarcinoma [ICD-11: 2B70.2] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | OE33 cellss | Esophagus | Homo sapiens (Human) | CVCL_0471 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qPCR | |||
Experiment for Drug Resistance |
CCK8 assay | |||
Mechanism Description | PTEN and TNF were demonstrated to be upregulated following miR-187 overexpression. TNF is a cytokine that regulates multiple cellular processes including proliferation and apoptosis. PTEN acts as a tumor suppressor and regulates the PI3k/AkT pathway, which has been identified as a radiation response pathway. The upregulation of PTEN enhances radiosensitivity via the downregulation of the PI3k/AkT pathway. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Peripheral T-cell lymphoma | [1] | |||
Resistant Disease | Peripheral T-cell lymphoma [ICD-11: 2A90.0] | |||
Resistant Drug | Cyclophosphamide | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
In Vitro Model | MOLT4 cells | Bone marrow | Homo sapiens (Human) | CVCL_0013 |
HUT78 cells | Lymph | Homo sapiens (Human) | CVCL_0337 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR187 downregulated tumor suppressor gene disabled homolog-2 (Dab2), decreased the interaction of Dab2 with adapter protein Grb2, resulting in Ras activation, phosphorylation/activation of extracellular signal-regulated kinase (ERk) and AkT, and subsequent stabilization of MYC oncoprotein. MiR187-overexpressing cells were resistant to chemotherapeutic agents like doxorubicin, cyclophosphamide, cisplatin and gemcitabine, but sensitive to the proteasome inhibitor bortezomib. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Peripheral T-cell lymphoma | [1] | |||
Resistant Disease | Peripheral T-cell lymphoma [ICD-11: 2A90.0] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
In Vitro Model | MOLT4 cells | Bone marrow | Homo sapiens (Human) | CVCL_0013 |
HUT78 cells | Lymph | Homo sapiens (Human) | CVCL_0337 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR187 downregulated tumor suppressor gene disabled homolog-2 (Dab2), decreased the interaction of Dab2 with adapter protein Grb2, resulting in Ras activation, phosphorylation/activation of extracellular signal-regulated kinase (ERk) and AkT, and subsequent stabilization of MYC oncoprotein. MiR187-overexpressing cells were resistant to chemotherapeutic agents like doxorubicin, cyclophosphamide, cisplatin and gemcitabine, but sensitive to the proteasome inhibitor bortezomib. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Peripheral T-cell lymphoma | [1] | |||
Resistant Disease | Peripheral T-cell lymphoma [ICD-11: 2A90.0] | |||
Resistant Drug | Gemcitabine | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
In Vitro Model | MOLT4 cells | Bone marrow | Homo sapiens (Human) | CVCL_0013 |
HUT78 cells | Lymph | Homo sapiens (Human) | CVCL_0337 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | miR187 downregulated tumor suppressor gene disabled homolog-2 (Dab2), decreased the interaction of Dab2 with adapter protein Grb2, resulting in Ras activation, phosphorylation/activation of extracellular signal-regulated kinase (ERk) and AkT, and subsequent stabilization of MYC oncoprotein. MiR187-overexpressing cells were resistant to chemotherapeutic agents like doxorubicin, cyclophosphamide, cisplatin and gemcitabine, but sensitive to the proteasome inhibitor bortezomib. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.