Molecule Information
General Information of the Molecule (ID: Mol01388)
Name |
hsa-mir-183
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 183
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR183
|
||||
Gene ID | |||||
Location |
chr7:129774905-129775014[-]
|
||||
Sequence |
CCGCAGAGUGUGACUCCUGUUCUGUGUAUGGCACUGGUAGAAUUCACUGUGAACAGUCUC
AGUCAGUGAAUUACCGAAGGGCCAUAAACAGAGCAGAGACAGAUCCACGA Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Nasopharyngeal carcinoma | [1] | |||
Sensitive Disease | Nasopharyngeal carcinoma [ICD-11: 2B6B.0] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell proliferation | Activation | hsa05200 | |
Tumorigenesis | Activation | hsa05206 | ||
In Vitro Model | 5-8F cells | Nasopharynx | Homo sapiens (Human) | CVCL_C528 |
CNE2 cells | Nasopharynx | Homo sapiens (Human) | CVCL_6889 | |
C666-1 cells | Throat | Homo sapiens (Human) | CVCL_7949 | |
CNE1 cells | Throat | Homo sapiens (Human) | CVCL_6888 | |
HONE1 cells | Throat | Homo sapiens (Human) | CVCL_8706 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis | |||
Mechanism Description | miR183 overexpression inhibits tumorigenesis and enhances DDP-induced cytotoxicity by targeting MTA1 in nasopharyngeal carcinoma. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Prostate cancer | [2] | |||
Sensitive Disease | Prostate cancer [ICD-11: 2C82.0] | |||
Sensitive Drug | Docetaxel | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | ERK signaling pathway | Regulation | hsa04210 | |
RTK signaling pathway | Inhibition | hsa04015 | ||
In Vitro Model | DU-145 cells | Prostate | Homo sapiens (Human) | CVCL_0105 |
LNCaP cells | Prostate | Homo sapiens (Human) | CVCL_0395 | |
PC3 cells | Prostate | Homo sapiens (Human) | CVCL_0035 | |
RWPE-1 cells | Prostate | Homo sapiens (Human) | CVCL_3791 | |
C4-2 cells | Prostate | Homo sapiens (Human) | CVCL_4782 | |
Experiment for Molecule Alteration |
Immunoblotting assay | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometer assay | |||
Mechanism Description | CASC2 directly targets miR183 to inhibit its expression. SPRY2 is regarded as a negative regulator RTk signaling pathway, antagonizing cell migration and/or cellular differentiation occurring through the ERk signaling. CASC2 competes with SPRY2 for miR183 binding to rescue the expression of SPRY2 in PC cells, thus suppressing the cell proliferation and promoting the apoptosis of PC cells, finally enhancing PC cells chemo-sensitivity to docetaxel through SPRY2 downstream ERk signaling pathway. |
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Hepatocellular cancer | [3] | |||
Sensitive Disease | Hepatocellular cancer [ICD-11: 2C12.4] | |||
Sensitive Drug | Fluorouracil | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell proliferation | Inhibition | hsa05200 | |
miR183/IDH2/SOCS6/HIF1alpha feedback loop signaling pathway | Regulation | hsa05206 | ||
In Vitro Model | BEL-7402 cells | Liver | Homo sapiens (Human) | CVCL_5492 |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | IDH2 knockdown resulted in significantly increased HIF-1alpha expression in both BEL-7402 and BEL-7402/5-FU cells. knockdown of SOCS6 had similar but stronger effect as miR-183 in promoting MRP2, P-gp, p-STAT3 and HIF-1alpha expression in BEL-7402 cells, while SOCS6 overexpression also showed similar but stronger effect as miR-183 inhibition in reducing MRP2, P-gp, p-STAT3 and HIF-1alpha levels in BEL-7402/5-FU cells. Both SOCS6 overexpression and miR-183 knockdown significantly increased the sensitivity of BEL-7402/5-FU cells to 5-FU. miR-183 overexpression partly abrogated the effect of SOCS6 in enhancing 5-FU sensitivity. |
References
visits since 2022
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.