General Information of the Molecule (ID: Mol01388)
Name
hsa-mir-183 ,Homo sapiens
Synonyms
microRNA 183
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR183
Gene ID
406959
Location
chr7:129774905-129775014[-]
Sequence
CCGCAGAGUGUGACUCCUGUUCUGUGUAUGGCACUGGUAGAAUUCACUGUGAACAGUCUC
AGUCAGUGAAUUACCGAAGGGCCAUAAACAGAGCAGAGACAGAUCCACGA
    Click to Show/Hide
Ensembl ID
ENSG00000207691
HGNC ID
HGNC:31554
Precursor Accession
MI0000273
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
6 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Nasopharyngeal carcinoma [ICD-11: 2B6B.0] [1]
Sensitive Disease Nasopharyngeal carcinoma [ICD-11: 2B6B.0]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
Tumorigenesis Activation hsa05206
In Vitro Model 5-8F cells Nasopharynx Homo sapiens (Human) CVCL_C528
CNE2 cells Nasopharynx Homo sapiens (Human) CVCL_6889
C666-1 cells Throat Homo sapiens (Human) CVCL_7949
CNE1 cells Throat Homo sapiens (Human) CVCL_6888
HONE1 cells Throat Homo sapiens (Human) CVCL_8706
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometric analysis
Mechanism Description miR183 overexpression inhibits tumorigenesis and enhances DDP-induced cytotoxicity by targeting MTA1 in nasopharyngeal carcinoma.
Docetaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [2]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
Sensitive Drug Docetaxel
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation ERK signaling pathway Regulation N.A.
RTK signaling pathway Inhibition hsa04015
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
LNCaP cells Prostate Homo sapiens (Human) CVCL_0395
PC3 cells Prostate Homo sapiens (Human) CVCL_0035
RWPE-1 cells Prostate Homo sapiens (Human) CVCL_3791
C4-2 cells Prostate Homo sapiens (Human) CVCL_4782
Experiment for
Molecule Alteration
Immunoblotting assay
Experiment for
Drug Resistance
MTT assay; Flow cytometer assay
Mechanism Description CASC2 directly targets miR183 to inhibit its expression. SPRY2 is regarded as a negative regulator RTk signaling pathway, antagonizing cell migration and/or cellular differentiation occurring through the ERk signaling. CASC2 competes with SPRY2 for miR183 binding to rescue the expression of SPRY2 in PC cells, thus suppressing the cell proliferation and promoting the apoptosis of PC cells, finally enhancing PC cells chemo-sensitivity to docetaxel through SPRY2 downstream ERk signaling pathway.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [3]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Immunodeficient mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR; Luciferase assay
Experiment for
Drug Resistance
Cell cycle analysis; Apoptosis analysis
Mechanism Description This gene is up-regulated in doxorubicin-sensitive cells
Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [3]
Sensitive Disease Renal cell carcinoma [ICD-11: 2C90.0]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Immunodeficient mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR; Luciferase assay
Experiment for
Drug Resistance
Cell cycle analysis; Apoptosis analysis
Mechanism Description This gene is up-regulated in doxorubicin-sensitive cells
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular cancer [ICD-11: 2C12.4] [4]
Sensitive Disease Hepatocellular cancer [ICD-11: 2C12.4]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
miR183/IDH2/SOCS6/HIF1alpha feedback loop signaling pathway Regulation N.A.
In Vitro Model BEL-7402 cells Liver Homo sapiens (Human) CVCL_5492
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description IDH2 knockdown resulted in significantly increased HIF-1alpha expression in both BEL-7402 and BEL-7402/5-FU cells. knockdown of SOCS6 had similar but stronger effect as miR-183 in promoting MRP2, P-gp, p-STAT3 and HIF-1alpha expression in BEL-7402 cells, while SOCS6 overexpression also showed similar but stronger effect as miR-183 inhibition in reducing MRP2, P-gp, p-STAT3 and HIF-1alpha levels in BEL-7402/5-FU cells. Both SOCS6 overexpression and miR-183 knockdown significantly increased the sensitivity of BEL-7402/5-FU cells to 5-FU. miR-183 overexpression partly abrogated the effect of SOCS6 in enhancing 5-FU sensitivity.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [5]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
Resistant Drug Imatinib
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Caspase-3 activity assay
Mechanism Description Duplicate experiments demonstrated that 15 miRNAs had a >2-fold increase in expression in MYL-R cells relative to MYL cells and that 15 miRNAs showed a >2-fold decrease in relative expression.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [6]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
LCC2 cells Breast Homo sapiens (Human) CVCL_DP51
LCC9 cells Breast Homo sapiens (Human) CVCL_DP52
Experiment for
Molecule Alteration
Microarray analyses; qPCR; RT-PCR; Western blot
Mechanism Description Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.
References
Ref 1 MiR-183 overexpression inhibits tumorigenesis and enhances DDP-induced cytotoxicity by targeting MTA1 in nasopharyngeal carcinoma. Tumour Biol. 2017 Jun;39(6):1010428317703825. doi: 10.1177/1010428317703825.
Ref 2 Long non-coding RNA CASC2 regulates Sprouty2 via functioning as a competing endogenous RNA for miR-183 to modulate the sensitivity of prostate cancer cells to docetaxel. Arch Biochem Biophys. 2019 Apr 15;665:69-78. doi: 10.1016/j.abb.2018.01.013. Epub 2018 Jan 31.
Ref 3 The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
Ref 4 MiR-183 modulates multi-drug resistance in hepatocellular cancer (HCC) cells via miR-183-IDH2/SOCS6-HIF-1Alpha feedback loop. Eur Rev Med Pharmacol Sci. 2016 May;20(10):2020-7.
Ref 5 MiR-34a attenuates paclitaxel-resistance of hormone-refractory prostate cancer PC3 cells through direct and indirect mechanisms. Prostate. 2010 Oct 1;70(14):1501-12. doi: 10.1002/pros.21185.
Ref 6 PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.