General Information of the Molecule (ID: Mol01387)
Name
hsa-mir-182 ,Homo sapiens
Synonyms
microRNA 182
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR182
Gene ID
406958
Location
chr7:129770383-129770492[-]
Sequence
GAGCUGCUUGCCUCCCCCCGUUUUUGGCAAUGGUAGAACUCACACUGGUGAGGUAACAGG
AUCCGGUGGUUCUAGACUUGCCAACUAUGGGGCGAGGACUCAGCCGGCAC
    Click to Show/Hide
Ensembl ID
ENSG00000207990
HGNC ID
HGNC:31553
Precursor Accession
MI0000272
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
4 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [1]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The expression level of miR-182 in A549 cell line was significantly higher than that in NHBE cell line. Transfection of miR-182 inhibitor induced sensitivity of A549 cells to cisplatin. A549 cells transfected with PDCD4 siRNA became more resistant to cisplatin therapy. We found an increase PDCD4 protein level following the transfection of miR-182 inhibitor using Western blot analysis. In addition, the (+) growth-inhibitory effect by miR-182 inhibitor was weakened after the addition of PDCD4 siRNA.
Disease Class: Hepatocellular carcinoma [2]
Resistant Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation miR182/TP53INP1 signaling pathway Regulation hsa05206
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
HEK293 cells Kidney Homo sapiens (Human) CVCL_0045
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-182 levels are significantly increased in HCC patients treated with cisplatin-based chemotherapy. Upregulated miR-182 inhibits TP53INP1 expression, which results in sequent cisplatin resistance.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [3]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
PI3K/AKT signaling pathway Activation hsa04151
In Vitro Model HCT-8 cells Colon Homo sapiens (Human) CVCL_2478
LOVO cells Colon Homo sapiens (Human) CVCL_0399
HCT-8/5-FU cells Colon Homo sapiens (Human) CVCL_2478
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description Upregulation of microRNA-135b and microRNA-182 promotes chemoresistance of colorectal cancer by targeting ST6GALNAC2 via PI3k/AkT pathway. Inhibition of the PI3k/AkT pathway enhanced the chemosensitivity to 5-FU in HCT-8/5-FU and LoVo/5-FU.
Olaparib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [4]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Olaparib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
K562 cells Blood Homo sapiens (Human) CVCL_0004
In Vivo Model CD1 nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qPCR
Experiment for
Drug Resistance
Clonogenic assay
Mechanism Description miR-182-mediated down-regulation of BRCA1 impedes DNA repair, and lead to Olaparib resistance.
Trastuzumab
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [5]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Trastuzumab
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell autophagy Inhibition hsa04140
MET/PI3K/AKT/mTOR signaling pathway Activation hsa04150
In Vitro Model SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
BT474 cells Breast Homo sapiens (Human) CVCL_0179
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTS assay; Transwell assay
Mechanism Description Overexpression of miR-182 reduced trastuzumab resistance in trastuzumab-resistant cells due in part to MET/PI3k/AkT/mTOR signaling pathway inactivation.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Oncolytic vaccinia virus
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [6]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Oncolytic vaccinia virus
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model CaCo2 cells Colon Homo sapiens (Human) CVCL_0025
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
Virus binding and entry assays
Mechanism Description Long noncoding RNA UCA1 enhances sensitivity to oncolytic vaccinia virus by sponging miR-18a/miR-182 and modulating the Cdc42/filopodia axis in colorectal cancer.
Investigative Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Iodine-131
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Thyroid carcinoma [7]
Resistant Disease Thyroid carcinoma [ICD-11: 2D10.4]
Resistant Drug Iodine-131
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Inhibition hsa05200
In Vitro Model TPC-1 cells Thyroid Homo sapiens (Human) CVCL_6298
FTC-133 cells Thyroid Homo sapiens (Human) CVCL_1219
Experiment for
Molecule Alteration
qRT-PCR; Luciferase reporter assay
Experiment for
Drug Resistance
CCK8 assay; Flow cytometry assay
Mechanism Description MEG3 expression was decreased while miR-182 expression was increased in 131I-resistant TC cells.
References
Ref 1 MicroRNA-182 modulates chemosensitivity of human non-small cell lung cancer to cisplatin by targeting PDCD4. Diagn Pathol. 2014 Jul 10;9:143. doi: 10.1186/1746-1596-9-143.
Ref 2 Upregulated miR-182 increases drug resistance in cisplatin-treated HCC cell by regulating TP53INP1. Gene. 2014 Apr 1;538(2):342-7. doi: 10.1016/j.gene.2013.12.043. Epub 2014 Jan 19.
Ref 3 Upregulation of microRNA-135b and microRNA-182 promotes chemoresistance of colorectal cancer by targeting ST6GALNAC2 via PI3K/AKT pathway. Mol Carcinog. 2017 Dec;56(12):2669-2680. doi: 10.1002/mc.22710. Epub 2017 Aug 21.
Ref 4 miR-182-mediated downregulation of BRCA1 impacts DNA repair and sensitivity to PARP inhibitors. Mol Cell. 2011 Jan 21;41(2):210-20. doi: 10.1016/j.molcel.2010.12.005. Epub 2010 Dec 30.
Ref 5 miR-182 regulates trastuzumab resistance by targeting MET in breast cancer cells. Cancer Gene Ther. 2019 Feb;26(1-2):1-10. doi: 10.1038/s41417-018-0031-4. Epub 2018 Jun 21.
Ref 6 Long noncoding RNA UCA1 enhances sensitivity to oncolytic vaccinia virus by sponging miR-18a/miR-182 and modulating the Cdc42/filopodia axis in colorectal cancer. Biochem Biophys Res Commun. 2019 Aug 27;516(3):831-838. doi: 10.1016/j.bbrc.2019.06.125. Epub 2019 Jun 28.
Ref 7 LncRNA MEG3 enhances (131)I sensitivity in thyroid carcinoma via sponging miR-182. Biomed Pharmacother. 2018 Sep;105:1232-1239. doi: 10.1016/j.biopha.2018.06.087. Epub 2018 Jun 22.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.