Molecule Information

General Information of the Molecule (ID: Mol01380)

• Name: hsa-mir-10b ,Homo sapiens
• Synonyms: microRNA 10b
• Molecule Type: Precursor miRNA
• Gene Name: MIR10B
• Gene ID: 406903
• Location: chr2:176150303-176150412[+]
• Sequence:
  CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUA
  UAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA
• Ensembl ID: ENSG00000207744
• HGNC ID: HGNC:31498
• Precursor Accession: MI0000267

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [1]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR10b/BIM signaling pathway; Activation; hsa05206
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-10b directly inhibits pro-apoptotic BIM, and the overexpression of miR-10b confers chemoresistance in colorectal cancer cells to 5-FU.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [2]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [3]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: T47D cells; Breast; Homo sapiens (Human); CVCL_0553
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Transwell assay
• Mechanism Description: Over-expression of miR-10b in ER-positive MCF-7 and T47D cells led to increased resistance to tamoxifen and an attenuation of tamoxifen-mediated inhibition of migration, whereas down-regulation of miR-10b in MCF7TR cells resulted in increased sensitivity to tamoxifen. Luciferase assays identified HDAC4 as a direct target of miR-10b. In MCF7TR cells, we observed down-regulation of HDAC4 by miR-10b. HDAC4-specific siRNA-mediated inactivation of HDAC4 in MCF-7 cells led to acquisition of tamoxifen resistance, and, moreover, reduction of HDAC4 in MCF7TR cells by HDAC4-specific siRNA transfection resulted in further enhancement of tamoxifen-resistance.

References

• Ref 1: MicroRNA-10b is a prognostic indicator in colorectal cancer and confers resistance to the chemotherapeutic agent 5-fluorouracil in colorectal cancer cells. Ann Surg Oncol. 2012 Sep;19(9):3065-71. doi: 10.1245/s10434-012-2246-1. Epub 2012 Feb 10.
• Ref 2: miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
• Ref 3: Functional role of miR-10b in tamoxifen resistance of ER-positive breast cancer cells through down-regulation of HDAC4. BMC Cancer. 2015 Jul 24;15:540. doi: 10.1186/s12885-015-1561-x.