General Information of the Molecule (ID: Mol01380)
Name
hsa-mir-10b ,Homo sapiens
Synonyms
microRNA 10b
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR10B
Gene ID
406903
Location
chr2:176150303-176150412[+]
Sequence
CCAGAGGUUGUAACGUUGUCUAUAUAUACCCUGUAGAACCGAAUUUGUGUGGUAUCCGUA
UAGUCACAGAUUCGAUUCUAGGGGAAUAUAUGGUCGAUGCAAAAACUUCA
    Click to Show/Hide
Ensembl ID
ENSG00000207744
HGNC ID
HGNC:31498
Precursor Accession
MI0000267
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation miR10b/BIM signaling pathway Activation hsa05206
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-10b directly inhibits pro-apoptotic BIM, and the overexpression of miR-10b confers chemoresistance in colorectal cancer cells to 5-FU.
Gemcitabine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [2]
Resistant Disease Pancreatic cancer [ICD-11: 2C10.3]
Resistant Drug Gemcitabine
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [3]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Activation hsa05200
Cell migration Activation hsa04670
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
T47D cells Breast Homo sapiens (Human) CVCL_0553
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Transwell assay
Mechanism Description Over-expression of miR-10b in ER-positive MCF-7 and T47D cells led to increased resistance to tamoxifen and an attenuation of tamoxifen-mediated inhibition of migration, whereas down-regulation of miR-10b in MCF7TR cells resulted in increased sensitivity to tamoxifen. Luciferase assays identified HDAC4 as a direct target of miR-10b. In MCF7TR cells, we observed down-regulation of HDAC4 by miR-10b. HDAC4-specific siRNA-mediated inactivation of HDAC4 in MCF-7 cells led to acquisition of tamoxifen resistance, and, moreover, reduction of HDAC4 in MCF7TR cells by HDAC4-specific siRNA transfection resulted in further enhancement of tamoxifen-resistance.
References
Ref 1 MicroRNA-10b is a prognostic indicator in colorectal cancer and confers resistance to the chemotherapeutic agent 5-fluorouracil in colorectal cancer cells. Ann Surg Oncol. 2012 Sep;19(9):3065-71. doi: 10.1245/s10434-012-2246-1. Epub 2012 Feb 10.
Ref 2 miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
Ref 3 Functional role of miR-10b in tamoxifen resistance of ER-positive breast cancer cells through down-regulation of HDAC4. BMC Cancer. 2015 Jul 24;15:540. doi: 10.1186/s12885-015-1561-x.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.