General Information of the Molecule (ID: Mol01377)
Name
hsa-mir-147 ,Homo sapiens
Synonyms
microRNA 147a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR147A
Gene ID
406939
Location
chr9:120244979-120245050[-]
Sequence
AAUCUAAAGACAACAUUUCUGCACACACACCAGACUAUGGAAGCCAGUGUGUGGAAAUGC
UUCUGCUAGAUU
    Click to Show/Hide
Ensembl ID
ENSG00000207814
HGNC ID
HGNC:31534
Precursor Accession
MI0000262
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [1]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell proliferation Inhibition hsa05200
PI3K/AKT signaling pathway Inhibition hsa04151
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
AGS cells Gastric Homo sapiens (Human) CVCL_0139
MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometric analysis
Mechanism Description miR147 suppressed the proliferation and enhanced the chemosensitivity of gastric cancer cells to 5-FU by promoting cell apoptosis through directly targeting PTEN and regulating the PI3k/AkT signaling pathway. knockdown of pten reverses the effects of miR147 downregulation on gastric cancer cells.
Gefitinib
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [2]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
Sensitive Drug Gefitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-147 strikingly increased the sensitivity to EGFR inhibitor, gefitinib in cell with native resistance.
Disease Class: Lung cancer [2]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Gefitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-147 strikingly increased the sensitivity to EGFR inhibitor, gefitinib in cell with native resistance.
References
Ref 1 Downregulation of MicroRNA-147 Inhibits Cell Proliferation and Increases the Chemosensitivity of Gastric Cancer Cells to 5-Fluorouracil by Directly Targeting PTEN. Oncol Res. 2018 Jul 5;26(6):901-911. doi: 10.3727/096504017X15061902533715. Epub 2017 Sep 26.
Ref 2 MicroRNA-147 induces a mesenchymal-to-epithelial transition (MET) and reverses EGFR inhibitor resistance. PLoS One. 2014 Jan 15;9(1):e84597. doi: 10.1371/journal.pone.0084597. eCollection 2014.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.