Molecule Information
General Information of the Molecule (ID: Mol01377)
| Name |
hsa-mir-147
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 147a
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR147A
|
||||
| Gene ID | |||||
| Location |
chr9:120244979-120245050[-]
|
||||
| Sequence |
AAUCUAAAGACAACAUUUCUGCACACACACCAGACUAUGGAAGCCAGUGUGUGGAAAUGC
UUCUGCUAGAUU Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
2 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.1] | [1] | |||
| Sensitive Disease | Gastric cancer [ICD-11: 2B72.1] | |||
| Sensitive Drug | Fluorouracil | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell proliferation | Inhibition | hsa05200 | ||
| PI3K/AKT signaling pathway | Inhibition | hsa04151 | ||
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
| SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
| MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 | |
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
MTT assay; Flow cytometric analysis | |||
| Mechanism Description | miR147 suppressed the proliferation and enhanced the chemosensitivity of gastric cancer cells to 5-FU by promoting cell apoptosis through directly targeting PTEN and regulating the PI3k/AkT signaling pathway. knockdown of pten reverses the effects of miR147 downregulation on gastric cancer cells. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [2] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Gefitinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | SW480 cells | Colon | Homo sapiens (Human) | CVCL_0546 |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-147 strikingly increased the sensitivity to EGFR inhibitor, gefitinib in cell with native resistance. | |||
| Disease Class: Lung cancer [ICD-11: 2C25.5] | [2] | |||
| Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
| Sensitive Drug | Gefitinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell migration | Inhibition | hsa04670 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| In Vitro Model | A549 cells | Lung | Homo sapiens (Human) | CVCL_0023 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | miR-147 strikingly increased the sensitivity to EGFR inhibitor, gefitinib in cell with native resistance. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
