Molecule Information
General Information of the Molecule (ID: Mol01376)
| Name |
hsa-mir-139
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 139
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR139
|
||||
| Gene ID | |||||
| Location |
chr11:72615063-72615130[-]
|
||||
| Sequence |
GUGUAUUCUACAGUGCACGUGUCUCCAGUGUGGCUCGGAGGCUGGAGACGCGGCCCUGUU
GGAGUAAC Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Ovarian cancer [ICD-11: 2C73.0] | [1] | |||
| Sensitive Disease | Ovarian cancer [ICD-11: 2C73.0] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell viability | Inhibition | hsa05200 | |
| In Vitro Model | CAOV3 cells | Ovary | Homo sapiens (Human) | CVCL_0201 |
| SNU119 cells | Ovary | Homo sapiens (Human) | CVCL_5014 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | The expression of ATP7A/B was up-regulated in cisplatin-resistant ovarian cancer cell lines; miR-139 inversely regulates ATP7A/B expression through direct targeting, and affects ovarian cancer chemoresistance through regulation of ATP7A/B. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
