Molecule Information

General Information of the Molecule (ID: Mol01376)

• Name: hsa-mir-139 ,Homo sapiens
• Synonyms: microRNA 139
• Molecule Type: Precursor miRNA
• Gene Name: MIR139
• Gene ID: 406931
• Location: chr11:72615063-72615130[-]
• Sequence:
  GUGUAUUCUACAGUGCACGUGUCUCCAGUGUGGCUCGGAGGCUGGAGACGCGGCCCUGUU
  GGAGUAAC
• Ensembl ID: ENSG00000272036
• HGNC ID: HGNC:31526
• Precursor Accession: MI0000261

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [ICD-11: 2C73.0] [1]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: CAOV3 cells; Ovary; Homo sapiens (Human); CVCL_0201
• In Vitro Model: SNU119 cells; Ovary; Homo sapiens (Human); CVCL_5014
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The expression of ATP7A/B was up-regulated in cisplatin-resistant ovarian cancer cell lines; miR-139 inversely regulates ATP7A/B expression through direct targeting, and affects ovarian cancer chemoresistance through regulation of ATP7A/B.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [2]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MAPK signalling pathway; Regulation; N.A.
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• Experiment for Molecule Alteration: Small RNA library construction and sequencing; qRT-PCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Function annotation implied that these selected miRNAs affected many target genes mainly involved in MAPK signaling pathway.

Erlotinib

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [3]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Panc1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: CFPAC1 cells; Pancreas; Homo sapiens (Human); CVCL_1119
• In Vitro Model: HPAF-II cells; Pancreatic; Homo sapiens (Human); CVCL_0313
• In Vitro Model: Capan-2 cells; Pancreas; Homo sapiens (Human); CVCL_0026
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vivo Model: Female 7- to 9-week-old Nu/Nu mice (Harlan, FoxN1/nude); Mus musculus
• Experiment for Molecule Alteration: Western blot
• Experiment for Drug Resistance: Cell growth inhibition assays; Apoptosis analysis
• Mechanism Description: Since miR200 family is known to be crucially involved in regulating epithelial-to-mesenchymal transition (EMT), our findings support the notion that molecular programs regulating differentiation status of PDA cells determine susceptibility to combinations of MEK and EGFR inhibitors.

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [2]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Advanced renal cell carcinoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: Blood samples from 38 patients and 287 miRNAs were evaluated. Twenty-eight miRNAs of the 287 were related to poor response and 23 of the 287 were related to prolonged response to sunitinib treatment. Predictive models identified populations with differences in the established end points.

Clinical Trial Drug(s) 1 drug(s) in total

PD-0325901

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0] [3]

• Sensitive Disease: Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
• Sensitive Drug: PD-0325901
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Panc1 cells; Pancreas; Homo sapiens (Human); CVCL_0480
• In Vitro Model: CFPAC1 cells; Pancreas; Homo sapiens (Human); CVCL_1119
• In Vitro Model: HPAF-II cells; Pancreatic; Homo sapiens (Human); CVCL_0313
• In Vitro Model: Capan-2 cells; Pancreas; Homo sapiens (Human); CVCL_0026
• In Vitro Model: BxPC-3 cells; Pancreas; Homo sapiens (Human); CVCL_0186
• In Vivo Model: Female 7- to 9-week-old Nu/Nu mice (Harlan, FoxN1/nude); Mus musculus
• Experiment for Molecule Alteration: Western blot
• Experiment for Drug Resistance: Cell growth inhibition assays; Apoptosis analysis
• Mechanism Description: Since miR200 family is known to be crucially involved in regulating epithelial-to-mesenchymal transition (EMT), our findings support the notion that molecular programs regulating differentiation status of PDA cells determine susceptibility to combinations of MEK and EGFR inhibitors.

References

• Ref 1: MircroRNA-139 sensitizes ovarian cancer cell to cisplatin-based chemotherapy through regulation of ATP7A/B. Cancer Chemother Pharmacol. 2018 May;81(5):935-947. doi: 10.1007/s00280-018-3548-1. Epub 2018 Mar 28.
• Ref 2: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 3: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.