General Information of the Molecule (ID: Mol01375)
Name
hsa-mir-30d ,Homo sapiens
Synonyms
microRNA 30d
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR30D
Gene ID
407033
Location
chr8:134804876-134804945[-]
Sequence
GUUGUUGUAAACAUCCCCGACUGGAAGCUGUAAGACACAGCUAAGCUUUCAGUCAGAUGU
UUGCUGCUAC
    Click to Show/Hide
Ensembl ID
ENSG00000199153
HGNC ID
HGNC:31628
Precursor Accession
MI0000255
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [1]
Sensitive Disease Glioma [ICD-11: 2A00.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model T98G cells Brain Homo sapiens (Human) CVCL_0556
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy.
Disease Class: Breast cancer [1]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy.
Disease Class: Lung cancer [1]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model H1299 cells Lung Homo sapiens (Human) CVCL_0060
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy.
Disease Class: Anaplastic thyroid carcinoma [1]
Sensitive Disease Anaplastic thyroid carcinoma [ICD-11: 2D10.3]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model 8305C cells Thyroid Homo sapiens (Human) CVCL_1053
SW1736 cells Thyroid Homo sapiens (Human) CVCL_3883
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Trichostatin A
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon carcinoma [2]
Resistant Disease Colon carcinoma [ICD-11: 2B90.2]
Resistant Drug Trichostatin A
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model J82 cells Bladder Homo sapiens (Human) CVCL_0359
UM-UC-3 cells Bladder Homo sapiens (Human) CVCL_1783
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.
Disease Class: Prostate cancer [2]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
Resistant Drug Trichostatin A
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.
Disease Class: Adult acute myeloid leukemia [2]
Resistant Disease Adult acute myeloid leukemia [ICD-11: 2A60.1]
Resistant Drug Trichostatin A
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.
Disease Class: Bladder carcinoma [2]
Resistant Disease Bladder carcinoma [ICD-11: 2C94.1]
Resistant Drug Trichostatin A
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
GES-1 cells Gastric Homo sapiens (Human) CVCL_EQ22
MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
Experiment for
Molecule Alteration
RT-PCR; qRT-PCR
Experiment for
Drug Resistance
Flow cytometry assay
Mechanism Description GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.
References
Ref 1 Regulation of autophagy by miR-30d impacts sensitivity of anaplastic thyroid carcinoma to cisplatin. Biochem Pharmacol. 2014 Feb 15;87(4):562-70. doi: 10.1016/j.bcp.2013.12.004. Epub 2013 Dec 15.
Ref 2 miR-30d, miR-181a and miR-199a-5p cooperatively suppress the endoplasmic reticulum chaperone and signaling regulator GRP78 in cancer. Oncogene. 2013 Sep 26;32(39):4694-701. doi: 10.1038/onc.2012.483. Epub 2012 Oct 22.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.