Molecule Information
General Information of the Molecule (ID: Mol01375)
Name |
hsa-mir-30d
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 30d
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR30D
|
||||
Gene ID | |||||
Location |
chr8:134804876-134804945[-]
|
||||
Sequence |
GUUGUUGUAAACAUCCCCGACUGGAAGCUGUAAGACACAGCUAAGCUUUCAGUCAGAUGU
UUGCUGCUAC Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Glioma | [1] | |||
Sensitive Disease | Glioma [ICD-11: 2A00.1] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | T98G cells | Brain | Homo sapiens (Human) | CVCL_0556 |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy. | |||
Disease Class: Breast cancer | [1] | |||
Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | MDA-MB-468 cells | Breast | Homo sapiens (Human) | CVCL_0419 |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy. | |||
Disease Class: Lung cancer | [1] | |||
Sensitive Disease | Lung cancer [ICD-11: 2C25.5] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | H1299 cells | Lung | Homo sapiens (Human) | CVCL_0060 |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy. | |||
Disease Class: Anaplastic thyroid carcinoma | [1] | |||
Sensitive Disease | Anaplastic thyroid carcinoma [ICD-11: 2D10.3] | |||
Sensitive Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
Cell proliferation | Inhibition | hsa05200 | ||
In Vitro Model | 8305C cells | Thyroid | Homo sapiens (Human) | CVCL_1053 |
SW1736 cells | Thyroid | Homo sapiens (Human) | CVCL_3883 | |
In Vivo Model | BALB/c nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
MTT assay | |||
Mechanism Description | The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy. |
Clinical Trial Drug(s)
1 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Colon carcinoma | [2] | |||
Resistant Disease | Colon carcinoma [ICD-11: 2B90.2] | |||
Resistant Drug | Trichostatin A | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | J82 cells | Bladder | Homo sapiens (Human) | CVCL_0359 |
UM-UC-3 cells | Bladder | Homo sapiens (Human) | CVCL_1783 | |
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance. | |||
Disease Class: Prostate cancer | [2] | |||
Resistant Disease | Prostate cancer [ICD-11: 2C82.0] | |||
Resistant Drug | Trichostatin A | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | HL60 cells | Peripheral blood | Homo sapiens (Human) | CVCL_0002 |
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance. | |||
Disease Class: Adult acute myeloid leukemia | [2] | |||
Resistant Disease | Adult acute myeloid leukemia [ICD-11: 2A60.1] | |||
Resistant Drug | Trichostatin A | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 |
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance. | |||
Disease Class: Bladder carcinoma | [2] | |||
Resistant Disease | Bladder carcinoma [ICD-11: 2C94.1] | |||
Resistant Drug | Trichostatin A | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
SGC7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
GES-1 cells | Gastric | Homo sapiens (Human) | CVCL_EQ22 | |
MkN-45 cells | Gastric | Homo sapiens (Human) | CVCL_0434 | |
Experiment for Molecule Alteration |
RT-PCR; qRT-PCR | |||
Experiment for Drug Resistance |
Flow cytometry assay | |||
Mechanism Description | GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.