Molecule Information

General Information of the Molecule (ID: Mol01375)
Name
hsa-mir-30d ,Homo sapiens
Synonyms
microRNA 30d
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR30D
Gene ID
407033
Location
chr8:134804876-134804945[-]
Sequence
GUUGUUGUAAACAUCCCCGACUGGAAGCUGUAAGACACAGCUAAGCUUUCAGUCAGAUGU
UUGCUGCUAC
    Click to Show/Hide
Ensembl ID
ENSG00000199153
HGNC ID
HGNC:31628
Precursor Accession
MI0000255
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [ICD-11: 2B90.1] [1]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Resistant Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model DLD-1 cells Colon Homo sapiens (Human) CVCL_0248
KM12C cells Colon Homo sapiens (Human) CVCL_9547
DLD-1 cells Colon Homo sapiens (Human) CVCL_0248
KM12C cells Colon Homo sapiens (Human) CVCL_9547
Experiment for
Molecule Alteration		 MiRNA microarray; qRT-PCR; mRNA immunoprecipitation
Experiment for
Drug Resistance		 Cell proliferation assay; Flow cytometry
Mechanism Description We revealed up-regulation of miR-19b in response to 5-FU and potential targets of miR-19b mediating the cell cycle under treatment with 5-FU.
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioma [ICD-11: 2A00.1] [2]
Sensitive Disease Glioma [ICD-11: 2A00.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model T98G cells Brain Homo sapiens (Human) CVCL_0556
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy.
Disease Class: Breast cancer [ICD-11: 2C60.3] [2]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy.
Disease Class: Lung cancer [ICD-11: 2C25.5] [2]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model H1299 cells Lung Homo sapiens (Human) CVCL_0060
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy.
Disease Class: Anaplastic thyroid carcinoma [ICD-11: 2D10.3] [2]
Sensitive Disease Anaplastic thyroid carcinoma [ICD-11: 2D10.3]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model 8305C cells Thyroid Homo sapiens (Human) CVCL_1053
SW1736 cells Thyroid Homo sapiens (Human) CVCL_3883
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The effect of miR-30d on cisplatin sensitivity is mediated through the beclin 1-regulated autophagy.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [3]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.0]
 Disease Info 
Resistant Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vivo Model Lung cancer patients Homo sapiens
Experiment for
Molecule Alteration		 qRT-PCR, Mann-Whitney U test
Experiment for
Drug Resistance		 WST-8 test
Mechanism Description We compared the miRNA expression levels between benign and malignant effusions using a Mann-Whitney U test and found miR-24, miR-26a and miR-30d were expressed differently between the two groups (P = 0.006, 0.021 and 0.011, respectively). Cells isolated from effusions rich in cell-free miR-152 were more sensitive to docetaxel (r = 0.60, P = 0.016). Collectively, our study demonstrated that cell-free miRNAs in the supernatant of effusions may aid in the diagnosis of malignancy and predict chemosensitivity to docetaxel.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [4]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Etoposide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [5]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Etoposide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation MRP-1/ABCC1 Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR; Luciferase reporter assay; Western blot; Immunofluorescence staining
Experiment for
Drug Resistance		 MTS assay
Mechanism Description Seventeen of miRNAs were differentially expressed in MCF-7/VP cells and their parent cells. The majority of these miRNAs exhibited increased expression levels, while miR-326, miR-429, miR-187, miR-7, and miR-92-2 showed decreased expression.
Clinical Trial Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Trichostatin A
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon carcinoma [ICD-11: 2B90.2] [7]
Resistant Disease Colon carcinoma [ICD-11: 2B90.2]
 Disease Info 
Resistant Drug Trichostatin A
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model J82 cells Bladder Homo sapiens (Human) CVCL_0359
UM-UC-3 cells Bladder Homo sapiens (Human) CVCL_1783
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.
Disease Class: Prostate cancer [ICD-11: 2C82.0] [7]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Resistant Drug Trichostatin A
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model HL60 cells Peripheral blood Homo sapiens (Human) CVCL_0002
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.
Disease Class: Adult acute myeloid leukemia [ICD-11: 2A60.1] [7]
Resistant Disease Adult acute myeloid leukemia [ICD-11: 2A60.1]
 Disease Info 
Resistant Drug Trichostatin A
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model HCT116 cells Colon Homo sapiens (Human) CVCL_0291
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.
Disease Class: Bladder carcinoma [ICD-11: 2C94.1] [7]
Resistant Disease Bladder carcinoma [ICD-11: 2C94.1]
 Disease Info 
Resistant Drug Trichostatin A
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model BGC-823 cells Gastric Homo sapiens (Human) CVCL_3360
MGC-803 cells Gastric Homo sapiens (Human) CVCL_5334
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
GES-1 cells Gastric Homo sapiens (Human) CVCL_EQ22
MkN-45 cells Gastric Homo sapiens (Human) CVCL_0434
Experiment for
Molecule Alteration		 RT-PCR; qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description GRP78 up-regulation is a major contributor to tumorigenesis and therapeutic resistance, miR-30d, miR-181a and miR-199a-5p regulate GRP78 and that their decreased expression in tumor cells results in increased GRP78 levels, which in turn promotes tumorigenesis and therapeutic resistance.
References
Ref 1 Ponatinib (AP24534), a multitargeted pan-FGFR inhibitor with activity in multiple FGFR-amplified or mutated cancer modelsMol Cancer Ther. 2012 Mar;11(3):690-9. doi: 10.1158/1535-7163.MCT-11-0450. Epub 2012 Jan 11.
Ref 2 Regulation of autophagy by miR-30d impacts sensitivity of anaplastic thyroid carcinoma to cisplatin. Biochem Pharmacol. 2014 Feb 15;87(4):562-70. doi: 10.1016/j.bcp.2013.12.004. Epub 2013 Dec 15.
Ref 3 Effects of CYP2C19 genotype on outcomes of clopidogrel treatment. N Engl J Med. 2010 Oct 28;363(18):1704-14. doi: 10.1056/NEJMoa1008410. Epub 2010 Aug 29.
Ref 4 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
Ref 5 Involvement of miR-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem Pharmacol. 2010 Mar 15;79(6):817-24. doi: 10.1016/j.bcp.2009.10.017. Epub 2009 Oct 31.
Ref 6 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 7 miR-30d, miR-181a and miR-199a-5p cooperatively suppress the endoplasmic reticulum chaperone and signaling regulator GRP78 in cancer. Oncogene. 2013 Sep 26;32(39):4694-701. doi: 10.1038/onc.2012.483. Epub 2012 Oct 22.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.