Molecule Information

General Information of the Molecule (ID: Mol01373)
Name
hsa-mir-148a ,Homo sapiens
Synonyms
microRNA 148a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR148A
Gene ID
406940
Location
chr7:25949919-25949986[-]
Sequence
GAGGCAAAGUUCUGAGACACUCCGACUCUGAGUAUGAUAGAAGUCAGUGCACUACAGAAC
UUUGUCUC
    Click to Show/Hide
Ensembl ID
ENSG00000199085
HGNC ID
HGNC:31535
Precursor Accession
MI0000253
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
9 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Kidney cancer [ICD-11: 2C90.1] [1]
Sensitive Disease Kidney cancer [ICD-11: 2C90.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Caspase signaling pathway Activation hsa04210
In Vitro Model Caki cells Kidney Homo sapiens (Human) CVCL_0234
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay; PI/Annexin staining assay
Mechanism Description miR148a increases the sensitivity to cisplatin by targeting Rab14 in renal cancer cells, transfection with the miR148a mimics resulted in the activation of caspase pathway.
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [2]
Sensitive Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Beta-catenin signaling pathway Inhibition hsa04520
Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell viability Inhibition hsa05200
In Vitro Model SW480 cells Colon Homo sapiens (Human) CVCL_0546
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay; Flow cytometry assay
Mechanism Description Overexpression of miR-148a suppressed expression of stem cell markers, inhibited sphere formation, invasion and migration, induced apoptosis, and reduced chemo-resistance in cisplatin-resistant SW480 cells while suppressing WNT10b expression and beta-catenin signaling activities.
Disease Class: Esophageal adenocarcinoma [ICD-11: 2B70.2] [3]
Sensitive Disease Esophageal adenocarcinoma [ICD-11: 2B70.2]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description miR-148a sensitized chemotherapy-sensitive oesophageal cancer cell lines to cisplatin and, to a lesser extent, to 5-flurouracil and attenuated resistance in chemotherapy-resistant variants.
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [3]
Sensitive Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description miR-148a sensitized chemotherapy-sensitive oesophageal cancer cell lines to cisplatin and, to a lesser extent, to 5-flurouracil and attenuated resistance in chemotherapy-resistant variants.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [4]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Resistant Drug Docetaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
In Vitro Model DU-145 cells Prostate Homo sapiens (Human) CVCL_0105
Experiment for
Molecule Alteration		 qPCR
Mechanism Description To confirm the results from global miRNA profiling, four miRNAs found to be decreased in the cells and exosomes of at least two of the three docetaxel-resistant cell line variants were selected for validation by qPCR. The expression of miR-598, miR-148a, miR-34a, and miR-146a confirmed the same trends as demonstrated in the global profiling.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [ICD-11: 2C12.0] [5]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Immunodeficient mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR; Luciferase assay
Experiment for
Drug Resistance		 Cell cycle analysis; Apoptosis analysis
Mechanism Description This gene is up-regulated in doxorubicin-sensitive cells
Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [5]
Sensitive Disease Renal cell carcinoma [ICD-11: 2C90.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model HepG2 cells Liver Homo sapiens (Human) CVCL_0027
Hela cells Cervix uteri Homo sapiens (Human) CVCL_0030
SNU182 cells Liver Homo sapiens (Human) CVCL_0090
SNU-739 cells Liver Homo sapiens (Human) CVCL_5088
769-P cells Kidney Homo sapiens (Human) CVCL_1050
786-O cells Kidney Homo sapiens (Human) CVCL_1051
In Vivo Model Immunodeficient mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR; Luciferase assay
Experiment for
Drug Resistance		 Cell cycle analysis; Apoptosis analysis
Mechanism Description This gene is up-regulated in doxorubicin-sensitive cells
Fluorouracil
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Esophageal adenocarcinoma [ICD-11: 2B70.2] [3]
Sensitive Disease Esophageal adenocarcinoma [ICD-11: 2B70.2]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description miR-148a sensitized chemotherapy-sensitive oesophageal cancer cell lines to cisplatin and, to a lesser extent, to 5-flurouracil and attenuated resistance in chemotherapy-resistant variants.
Disease Class: Esophageal squamous cell carcinoma [ICD-11: 2B70.3] [3]
Sensitive Disease Esophageal squamous cell carcinoma [ICD-11: 2B70.3]
 Disease Info 
Sensitive Drug Fluorouracil
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model kYSE410 cells Esophagus Homo sapiens (Human) CVCL_1352
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description miR-148a sensitized chemotherapy-sensitive oesophageal cancer cell lines to cisplatin and, to a lesser extent, to 5-flurouracil and attenuated resistance in chemotherapy-resistant variants.
Imatinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [6]
Resistant Disease Chronic myeloid leukemia [ICD-11: 2A20.0]
 Disease Info 
Resistant Drug Imatinib
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Caspase-3 activity assay
Mechanism Description Duplicate experiments demonstrated that 15 miRNAs had a >2-fold increase in expression in MYL-R cells relative to MYL cells and that 15 miRNAs showed a >2-fold decrease in relative expression.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [7]
Sensitive Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
MSK1 signaling pathway Inhibition hsa04010
In Vitro Model PC3PR cells Prostate Homo sapiens (Human) CVCL_0035
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Cell Growth Assay
Mechanism Description MSk1 is a novel target gene of miR-148a in both PC3 and PC3PR cells and miR-148 attenuates paclitaxel-resistance of PC3PR cells by modulating MSk1 expression.
Tamoxifen
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [8]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Tamoxifen
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Annexin V-FITC Apoptosis Detection assay; Flow cytometry assay
Mechanism Description miR148a and miR152 reduce tamoxifen resistance in ER+ breast cancer via downregulating ALCAM.
Verapamil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2] [9]
Resistant Disease Breast cancer [ICD-11: 2C60.2]
 Disease Info 
Resistant Drug Verapamil
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
Experiment for
Molecule Alteration		 MiRNA microarray; RT-PCR; Western blot
Experiment for
Drug Resistance		 MTT assay
Mechanism Description MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Gastric cancer [ICD-11: 2B72.0] [4]
Resistant Disease Gastric cancer [ICD-11: 2B72.0]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation MAPK signalling pathway Regulation N.A.
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration		 MiRNA microarray analyses, qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description In this study, mRNA and miRNA expression profiling of the drug resistant sublines, SGC7901/VCR and SGC7901/ADR, and their parental gastric cancer cell line SGC7901 were performed. A significant number of genes and a limited subset of miRNAs were commonly dysregulated, which were further validated using qRT-PCR. GO and KEGG pathway analyses of the commonly dysregulated genes indicated that the MAPK signalling pathway may be involved in multidrug resistance, which was further validated using immunoblotting and MTT assay.
References
Ref 1 miR-148a increases the sensitivity to cisplatin by targeting Rab14 in renal cancer cells. Int J Oncol. 2017 Mar;50(3):984-992. doi: 10.3892/ijo.2017.3851. Epub 2017 Jan 17.
Ref 2 MiR-148a suppressed cell invasion and migration via targeting WNT10b and modulating Beta-catenin signaling in cisplatin-resistant colorectal cancer cells. Biomed Pharmacother. 2019 Jan;109:902-909. doi: 10.1016/j.biopha.2018.10.080. Epub 2018 Nov 5.
Ref 3 Mir-148a improves response to chemotherapy in sensitive and resistant oesophageal adenocarcinoma and squamous cell carcinoma cells. J Gastrointest Surg. 2011 Mar;15(3):429-38. doi: 10.1007/s11605-011-1418-9. Epub 2011 Jan 19.
Ref 4 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
Ref 5 The Selective PI3K Inhibitor XL147 (SAR245408) Inhibits Tumor Growth and Survival and Potentiates the Activity of Chemotherapeutic Agents in Preclinical Tumor ModelsMol Cancer Ther. 2015 Apr;14(4):931-40. doi: 10.1158/1535-7163.MCT-14-0833. Epub 2015 Jan 30.
Ref 6 MiR-34a attenuates paclitaxel-resistance of hormone-refractory prostate cancer PC3 cells through direct and indirect mechanisms. Prostate. 2010 Oct 1;70(14):1501-12. doi: 10.1002/pros.21185.
Ref 7 MiR-148a attenuates paclitaxel resistance of hormone-refractory, drug-resistant prostate cancer PC3 cells by regulating MSK1 expression. J Biol Chem. 2010 Jun 18;285(25):19076-84. doi: 10.1074/jbc.M109.079525. Epub 2010 Apr 20.
Ref 8 MiR-148a and miR-152 reduce tamoxifen resistance in ER+ breast cancer via downregulating ALCAM. Biochem Biophys Res Commun. 2017 Feb 5;483(2):840-846. doi: 10.1016/j.bbrc.2017.01.012. Epub 2017 Jan 4.
Ref 9 The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.