Molecule Information

General Information of the Molecule (ID: Mol01371)
Name
hsa-mir-199a ,Homo sapiens
Synonyms
microRNA 199a-1
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR199A1
Gene ID
406976
Location
chr19:10817426-10817496[-]
Sequence
GCCAACCCAGUGUUCAGACUACCUGUUCAGGAGGCUCUCAAUGUGUACAGUAGUCUGCAC
AUUGGUUAGGC
    Click to Show/Hide
Ensembl ID
ENSG00000207752
HGNC ID
HGNC:31571
Precursor Accession
MI0000242
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colorectal cancer [ICD-11: 2B91.1] [1]
Resistant Disease Colorectal cancer [ICD-11: 2B91.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Wnt/Beta-catenin signaling pathway Regulation N.A.
In Vitro Model ALDHA1+ CCSCs cells Colon Homo sapiens (Human) N.A.
ALDHA1 cells Colon Homo sapiens (Human) N.A.
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay; MTT assay
Mechanism Description Upregulation of miR199a/b contributes to cisplatin resistance via Wnt/beta-catenin-ABCG2 signaling pathway in ALDHA1+ colorectal cancer stem cells. Gsk3beta was the direct target of miR199a/b, miR199a/b regulates Wnt/beta-catenin pathway by targeting Gsk3beta in ALDHA1+ CCSCs.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model CD44+/CD117+ ovarian CICs cells Ovary Homo sapiens (Human) N.A.
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description CD44 plays an important role in cellular adhesion, lymphocyte activation/migration, tumorigenesis, and the formation of metastases, endogenous mature miR-199a may prevent the growth of human ovarian CICs via decreasing the expression of CD44.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [3]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
miR199a/MRP1 signaling pathway Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7/ADR cells Breast Homo sapiens (Human) CVCL_1452
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 XTT assay; Flow cytometry assay; Caspase 9 activity assay
Mechanism Description Linc00518 downregulation reduced MDR by upregulating miR-199a which downregulates MRP1 in breast cancer.
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [4]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SUDHL-4 cells Peritoneal effusion Homo sapiens (Human) CVCL_0539
Karpas-422 cells Peritoneal effusion Homo sapiens (Human) CVCL_1325
RI-1 cells Peritoneal effusion Homo sapiens (Human) CVCL_1885
U2932 cells Peritoneal effusion Homo sapiens (Human) CVCL_1896
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description High expression of miR-497 or miR-199a was associated with better overall survival (p = 0.042 and p = 0.007). Overexpression of miR-199a and miR-497 led to a statistically significant decrease in viable cells in a dose-dependent fashion after exposure to rituximab and various chemotherapeutics relevant in multi-agent lymphoma therapy. Our data indicate that elevated miR-199a and miR-497 levels are associated with improved survival in aggressive lymphoma patients most likely by modifying drug sensitivity to immunochemotherapy. This functional impairment may serve as a potential novel therapeutic target in future treatment of patients with DLBCL. Overexpression of the individual miRNAs did not result in any difference in cell viability, cell growth or apoptosis.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model CD44+/CD117+ ovarian CICs cells Ovary Homo sapiens (Human) N.A.
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description CD44 plays an important role in cellular adhesion, lymphocyte activation/migration, tumorigenesis, and the formation of metastases, endogenous mature miR-199a may prevent the growth of human ovarian CICs via decreasing the expression of CD44.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [5]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model PC3/TXR cells Prostate Homo sapiens (Human) CVCL_0035
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay; Annexin V-FITC and PI Flow cytometry assay
Mechanism Description Overexpression of miR199a inhibited PTX resistance. YES1 was a target of miR199a, and overexpression of YES1 reversed the effect of miR199a in suppressing PTX resistance. In vivo, miR199a increased tumor PTX sensitivity.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [3]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
miR199a/MRP1 signaling pathway Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7/ADR cells Breast Homo sapiens (Human) CVCL_1452
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 XTT assay; Flow cytometry assay; Caspase 9 activity assay
Mechanism Description Linc00518 downregulation reduced MDR by upregulating miR-199a which downregulates MRP1 in breast cancer.
Disease Class: Ovarian cancer [ICD-11: 2C73.0] [2]
Sensitive Disease Ovarian cancer [ICD-11: 2C73.0]
 Disease Info 
Sensitive Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell migration Activation hsa04670
Cell proliferation Activation hsa05200
In Vitro Model CD44+/CD117+ ovarian CICs cells Ovary Homo sapiens (Human) N.A.
In Vivo Model BALB/c nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description CD44 plays an important role in cellular adhesion, lymphocyte activation/migration, tumorigenesis, and the formation of metastases, endogenous mature miR-199a may prevent the growth of human ovarian CICs via decreasing the expression of CD44.
Rituximab
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [4]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Sensitive Drug Rituximab
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SUDHL-4 cells Peritoneal effusion Homo sapiens (Human) CVCL_0539
Karpas-422 cells Peritoneal effusion Homo sapiens (Human) CVCL_1325
RI-1 cells Peritoneal effusion Homo sapiens (Human) CVCL_1885
U2932 cells Peritoneal effusion Homo sapiens (Human) CVCL_1896
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description High expression of miR-497 or miR-199a was associated with better overall survival (p = 0.042 and p = 0.007). Overexpression of miR-199a and miR-497 led to a statistically significant decrease in viable cells in a dose-dependent fashion after exposure to rituximab and various chemotherapeutics relevant in multi-agent lymphoma therapy. Our data indicate that elevated miR-199a and miR-497 levels are associated with improved survival in aggressive lymphoma patients most likely by modifying drug sensitivity to immunochemotherapy. This functional impairment may serve as a potential novel therapeutic target in future treatment of patients with DLBCL. Overexpression of the individual miRNAs did not result in any difference in cell viability, cell growth or apoptosis.
Vincristine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.3] [3]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Sensitive Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell viability Inhibition hsa05200
miR199a/MRP1 signaling pathway Regulation N.A.
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MCF-7/ADR cells Breast Homo sapiens (Human) CVCL_1452
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 XTT assay; Flow cytometry assay; Caspase 9 activity assay
Mechanism Description Linc00518 downregulation reduced MDR by upregulating miR-199a which downregulates MRP1 in breast cancer.
Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.0] [4]
Sensitive Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Sensitive Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model SUDHL-4 cells Peritoneal effusion Homo sapiens (Human) CVCL_0539
Karpas-422 cells Peritoneal effusion Homo sapiens (Human) CVCL_1325
RI-1 cells Peritoneal effusion Homo sapiens (Human) CVCL_1885
U2932 cells Peritoneal effusion Homo sapiens (Human) CVCL_1896
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTS assay
Mechanism Description High expression of miR-497 or miR-199a was associated with better overall survival (p = 0.042 and p = 0.007). Overexpression of miR-199a and miR-497 led to a statistically significant decrease in viable cells in a dose-dependent fashion after exposure to rituximab and various chemotherapeutics relevant in multi-agent lymphoma therapy. Our data indicate that elevated miR-199a and miR-497 levels are associated with improved survival in aggressive lymphoma patients most likely by modifying drug sensitivity to immunochemotherapy. This functional impairment may serve as a potential novel therapeutic target in future treatment of patients with DLBCL. Overexpression of the individual miRNAs did not result in any difference in cell viability, cell growth or apoptosis.
References
Ref 1 Upregulation of miR-199a/b contributes to cisplatin resistance via Wnt/Beta-catenin-ABCG2 signaling pathway in ALDHA1(+) colorectal cancer stem cells. Tumour Biol. 2017 Jun;39(6):1010428317715155. doi: 10.1177/1010428317715155.
Ref 2 MicroRNA-199a targets CD44 to suppress the tumorigenicity and multidrug resistance of ovarian cancer-initiating cells. FEBS J. 2012 Jun;279(11):2047-59. doi: 10.1111/j.1742-4658.2012.08589.x. Epub 2012 Apr 24.
Ref 3 Linc00518 Contributes to Multidrug Resistance Through Regulating the MiR-199a/MRP1 Axis in Breast Cancer. Cell Physiol Biochem. 2018;48(1):16-28. doi: 10.1159/000491659. Epub 2018 Jul 12.
Ref 4 miR-199a and miR-497 Are Associated with Better Overall Survival due to Increased Chemosensitivity in Diffuse Large B-Cell Lymphoma Patients. Int J Mol Sci. 2015 Aug 5;16(8):18077-95. doi: 10.3390/ijms160818077.
Ref 5 MiR-199a suppresses prostate cancer paclitaxel resistance by targeting YES1. World J Urol. 2018 Mar;36(3):357-365. doi: 10.1007/s00345-017-2143-0. Epub 2017 Dec 4.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.