Molecule Information
General Information of the Molecule (ID: Mol01359)
| Name |
hsa-mir-98
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 98
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR98
|
||||
| Gene ID | |||||
| Location |
chrX:53556223-53556341[-]
|
||||
| Sequence |
AGGAUUCUGCUCAUGCCAGGGUGAGGUAGUAAGUUGUAUUGUUGUGGGGUAGGGAUAUUA
GGCCCCAAUUAGAAGAUAACUAUACAACUUACUACUUUCCCUGGUGUGUGGCAUAUUCA Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [2] | |||
| Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Resistant Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell colony | Activation | hsa05200 | |
| Cell proliferation | Activation | hsa05200 | ||
| Drp1 signaling pathway | Activation | hsa04668 | ||
| In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
| J82 cells | Bladder | Homo sapiens (Human) | CVCL_0359 | |
| RT4 cells | Bladder | Homo sapiens (Human) | CVCL_0036 | |
| SV-HUC-1 cells | Bladder | Homo sapiens (Human) | CVCL_3798 | |
| T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assay; Flow cytometry assay | |||
| Mechanism Description | microRNA-98 promotes drug resistance and regulates mitochondrial dynamics by targeting LASS2 in bladder cancer cells through Drp1 signaling. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Lung adenocarcinoma [ICD-11: 2C25.0] | [3] | |||
| Resistant Disease | Lung adenocarcinoma [ICD-11: 2C25.0] | |||
| Resistant Drug | Docetaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | SPC-A1 cells | Lung | Homo sapiens (Human) | CVCL_6955 |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
Clonogenic assay | |||
| Mechanism Description | Six miRNAs (miR-192, 200b, 194, 424, 98 and 212) exhibited more than 2-fold changes in their expression levels, which were validated by qRT-PCR. The expression of three miRNAs (miR-200b, 194 and 212) was significantly down-regulated in SPC-A1/docetaxel cells, while the expression of other three miRNAs (miR-192, 424 and 98) was significantly up-regulated in SPC-A1/docetaxel cells (P < 0.01). | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Bladder cancer [ICD-11: 2C94.0] | [2] | |||
| Resistant Disease | Bladder cancer [ICD-11: 2C94.0] | |||
| Resistant Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Activation | hsa05200 | ||
| Drp1 signaling pathway | Activation | hsa04668 | ||
| In Vitro Model | 5637 cells | Bladder | Homo sapiens (Human) | CVCL_0126 |
| J82 cells | Bladder | Homo sapiens (Human) | CVCL_0359 | |
| RT4 cells | Bladder | Homo sapiens (Human) | CVCL_0036 | |
| SV-HUC-1 cells | Bladder | Homo sapiens (Human) | CVCL_3798 | |
| T24 cells | Bladder | Homo sapiens (Human) | CVCL_0554 | |
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Colony formation assay; Flow cytometry assay | |||
| Mechanism Description | microRNA-98 promotes drug resistance and regulates mitochondrial dynamics by targeting LASS2 in bladder cancer cells through Drp1 signaling. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Leukemia [ICD-11: 2B33.6] | [4] | |||
| Sensitive Disease | Leukemia [ICD-11: 2B33.6] | |||
| Sensitive Drug | Doxorubicin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | K562 cells | Blood | Homo sapiens (Human) | CVCL_0004 |
| K562/A02 cells | Blood | Homo sapiens (Human) | CVCL_0368 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | The targeted upregulated expression of miR98 could decrease the proliferation of leukemia cells and improve the sensitivity to chemotherapeutics by inhibiting E2F1 expression. | |||
Clinical Trial Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Gastric cancer [ICD-11: 2B72.0] | [5] | |||
| Resistant Disease | Gastric cancer [ICD-11: 2B72.0] | |||
| Resistant Drug | Hydroxycamptothecin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| In Vitro Model | BGC-823 cells | Gastric | Homo sapiens (Human) | CVCL_3360 |
| SGC-7901 cells | Gastric | Homo sapiens (Human) | CVCL_0520 | |
| MGC-803 cells | Gastric | Homo sapiens (Human) | CVCL_5334 | |
| HGC27 cells | Gastric | Homo sapiens (Human) | CVCL_1279 | |
| NCI-N87 cells | Gastric | Homo sapiens (Human) | CVCL_1603 | |
| AGS cells | Gastric | Homo sapiens (Human) | CVCL_0139 | |
| Experiment for Molecule Alteration |
MiRNA microarray profiling, qRT-PCR | |||
| Experiment for Drug Resistance |
A sulforhodamine B (SRB) assay | |||
| Mechanism Description | MiR-196a, -365, -424, -98, -338, and -224 were markedly upregulated in the resistant cells, but not in the sensitive cells, while miR-99b, -141, -200a, -200b, -372, and -373 were markedly downregulated. The combined analysis revealed 78 relation pairs between the miRNAs and mRNAs. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
