General Information of the Molecule (ID: Mol01359)
Name
hsa-mir-98 ,Homo sapiens
Synonyms
microRNA 98
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR98
Gene ID
407054
Location
chrX:53556223-53556341[-]
Sequence
AGGAUUCUGCUCAUGCCAGGGUGAGGUAGUAAGUUGUAUUGUUGUGGGGUAGGGAUAUUA
GGCCCCAAUUAGAAGAUAACUAUACAACUUACUACUUUCCCUGGUGUGUGGCAUAUUCA
    Click to Show/Hide
Ensembl ID
ENSG00000271886
HGNC ID
HGNC:31649
Precursor Accession
MI0000100
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell colony Activation hsa05200
Cell proliferation Activation hsa05200
Drp1 signaling pathway Activation hsa04668
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
J82 cells Bladder Homo sapiens (Human) CVCL_0359
RT4 cells Bladder Homo sapiens (Human) CVCL_0036
SV-HUC-1 cells Bladder Homo sapiens (Human) CVCL_3798
T24 cells Bladder Homo sapiens (Human) CVCL_0554
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Colony formation assay; Flow cytometry assay
Mechanism Description microRNA-98 promotes drug resistance and regulates mitochondrial dynamics by targeting LASS2 in bladder cancer cells through Drp1 signaling.
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung adenocarcinoma [2]
Resistant Disease Lung adenocarcinoma [ICD-11: 2C25.0]
Resistant Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
Clonogenic assay
Mechanism Description Six miRNAs (miR-192, 200b, 194, 424, 98 and 212) exhibited more than 2-fold changes in their expression levels, which were validated by qRT-PCR. The expression of three miRNAs (miR-200b, 194 and 212) was significantly down-regulated in SPC-A1/docetaxel cells, while the expression of other three miRNAs (miR-192, 424 and 98) was significantly up-regulated in SPC-A1/docetaxel cells (P < 0.01).
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Bladder cancer [1]
Resistant Disease Bladder cancer [ICD-11: 2C94.0]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Activation hsa05200
Drp1 signaling pathway Activation hsa04668
In Vitro Model 5637 cells Bladder Homo sapiens (Human) CVCL_0126
J82 cells Bladder Homo sapiens (Human) CVCL_0359
RT4 cells Bladder Homo sapiens (Human) CVCL_0036
SV-HUC-1 cells Bladder Homo sapiens (Human) CVCL_3798
T24 cells Bladder Homo sapiens (Human) CVCL_0554
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
CCK8 assay; Colony formation assay; Flow cytometry assay
Mechanism Description microRNA-98 promotes drug resistance and regulates mitochondrial dynamics by targeting LASS2 in bladder cancer cells through Drp1 signaling.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Leukemia [3]
Sensitive Disease Leukemia [ICD-11: 2B33.6]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model K562 cells Blood Homo sapiens (Human) CVCL_0004
K562/A02 cells Blood Homo sapiens (Human) CVCL_0368
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description The targeted upregulated expression of miR98 could decrease the proliferation of leukemia cells and improve the sensitivity to chemotherapeutics by inhibiting E2F1 expression.
References
Ref 1 MicroRNA-98 promotes drug resistance and regulates mitochondrial dynamics by targeting LASS2 in bladder cancer cells. Exp Cell Res. 2018 Dec 15;373(1-2):188-197. doi: 10.1016/j.yexcr.2018.10.013. Epub 2018 Oct 25.
Ref 2 Identification of microRNA profiles in docetaxel-resistant human non-small cell lung carcinoma cells (SPC-A1). J Cell Mol Med. 2010 Jan;14(1-2):206-14. doi: 10.1111/j.1582-4934.2009.00964.x. Epub 2009 Nov 9.
Ref 3 Targeted regulation of MiR-98 on E2F1 increases chemosensitivity of leukemia cells K562/A02. Onco Targets Ther. 2017 Jun 29;10:3233-3239. doi: 10.2147/OTT.S126819. eCollection 2017.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.