Molecule Information

General Information of the Molecule (ID: Mol01355)

• Name: hsa-mir-33a ,Homo sapiens
• Synonyms: microRNA 33a
• Molecule Type: Precursor miRNA
• Gene Name: MIR33A
• Gene ID: 407039
• Location: chr22:41900944-41901012[+]
• Sequence:
  CUGUGGUGCAUUGUAGUUGCAUUGCAUGUUCUGGUGGUACCCAUGCAAUGUUUCCACAGU
  GCAUCACAG
• Ensembl ID: ENSG00000207932
• HGNC ID: HGNC:31634
• Precursor Accession: MI0000091

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 3 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Liver cancer [ICD-11: 2C12.6] [1]

• Resistant Disease: Liver cancer [ICD-11: 2C12.6]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Downregulated LncRNA CRNDE could up-regulate miR-33a expression and inhibit HMGA2 expression, thus it could significantly promote apoptosis of liver cancer drug-resistant cells on different chemotherapeutic drugs (ADM, DDP, 5-FU)and inhibit its proliferation, migration, invasion and drug resistance.

Disease Class: Osteosarcoma [ICD-11: 2B51.0] [2]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: TUNEL assay
• Mechanism Description: miR-33a is up-regulated in chemoresistant OS and that the miR-33a level is negatively correlated with the TWIST protein level in OS. miR-33a promotes OS cell resistance to cisplatin by down-regulating TWIST.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Liver cancer [ICD-11: 2C12.6] [1]

• Resistant Disease: Liver cancer [ICD-11: 2C12.6]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Downregulated LncRNA CRNDE could up-regulate miR-33a expression and inhibit HMGA2 expression, thus it could significantly promote apoptosis of liver cancer drug-resistant cells on different chemotherapeutic drugs (ADM, DDP, 5-FU)and inhibit its proliferation, migration, invasion and drug resistance.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Liver cancer [ICD-11: 2C12.6] [1]

• Resistant Disease: Liver cancer [ICD-11: 2C12.6]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Downregulated LncRNA CRNDE could up-regulate miR-33a expression and inhibit HMGA2 expression, thus it could significantly promote apoptosis of liver cancer drug-resistant cells on different chemotherapeutic drugs (ADM, DDP, 5-FU)and inhibit its proliferation, migration, invasion and drug resistance.

References

• Ref 1: Downregulation of long noncoding RNA CRNDE suppresses drug resistance of liver cancer cells by increasing microRNA-33a expression and decreasing HMGA2 expression. Cell Cycle. 2019 Oct;18(19):2524-2537. doi: 10.1080/15384101.2019.1652035. Epub 2019 Aug 15.
• Ref 2: miR-33a is up-regulated in chemoresistant osteosarcoma and promotes osteosarcoma cell resistance to cisplatin by down-regulating TWIST. J Exp Clin Cancer Res. 2014 Jan 27;33(1):12. doi: 10.1186/1756-9966-33-12.