Molecule Information

General Information of the Molecule (ID: Mol01355)

• Name: hsa-mir-33a ,Homo sapiens
• Synonyms: microRNA 33a
• Molecule Type: Precursor miRNA
• Gene Name: MIR33A
• Gene ID: 407039
• Location: chr22:41900944-41901012[+]
• Sequence:
  CUGUGGUGCAUUGUAGUUGCAUUGCAUGUUCUGGUGGUACCCAUGCAAUGUUUCCACAGU
  GCAUCACAG
• Ensembl ID: ENSG00000207932
• HGNC ID: HGNC:31634
• Precursor Accession: MI0000091

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 7 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Liver cancer [ICD-11: 2C12.6] [1]

• Resistant Disease: Liver cancer [ICD-11: 2C12.6]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Downregulated LncRNA CRNDE could up-regulate miR-33a expression and inhibit HMGA2 expression, thus it could significantly promote apoptosis of liver cancer drug-resistant cells on different chemotherapeutic drugs (ADM, DDP, 5-FU)and inhibit its proliferation, migration, invasion and drug resistance.

Disease Class: Osteosarcoma [ICD-11: 2B51.0] [2]

• Resistant Disease: Osteosarcoma [ICD-11: 2B51.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• In Vitro Model: MG63 cells; Bone marrow; Homo sapiens (Human); CVCL_0426
• In Vitro Model: SAOS-2 cells; Bone marrow; Homo sapiens (Human); CVCL_0548
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: TUNEL assay
• Mechanism Description: miR-33a is up-regulated in chemoresistant OS and that the miR-33a level is negatively correlated with the TWIST protein level in OS. miR-33a promotes OS cell resistance to cisplatin by down-regulating TWIST.

Cyclophosphamide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.1] [3]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.1]
• Resistant Drug: Cyclophosphamide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Diffuse large B cell lymphoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: MicroRNAs (miRNAs) are small, non-coding RNAs that posttranscriptionally regulate gene expression via suppression of specific target mRNAs.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Liver cancer [ICD-11: 2C12.6] [1]

• Resistant Disease: Liver cancer [ICD-11: 2C12.6]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Downregulated LncRNA CRNDE could up-regulate miR-33a expression and inhibit HMGA2 expression, thus it could significantly promote apoptosis of liver cancer drug-resistant cells on different chemotherapeutic drugs (ADM, DDP, 5-FU)and inhibit its proliferation, migration, invasion and drug resistance.

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Liver cancer [ICD-11: 2C12.6] [1]

• Resistant Disease: Liver cancer [ICD-11: 2C12.6]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• In Vitro Model: BEL-7402 cells; Liver; Homo sapiens (Human); CVCL_5492
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay; Flow cytometry assay
• Mechanism Description: Downregulated LncRNA CRNDE could up-regulate miR-33a expression and inhibit HMGA2 expression, thus it could significantly promote apoptosis of liver cancer drug-resistant cells on different chemotherapeutic drugs (ADM, DDP, 5-FU)and inhibit its proliferation, migration, invasion and drug resistance.

Prednisone

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Diffuse large B-cell lymphoma [ICD-11: 2A81.1] [3]

• Resistant Disease: Diffuse large B-cell lymphoma [ICD-11: 2A81.1]
• Resistant Drug: Prednisone
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Diffuse large B cell lymphoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: MicroRNAs (miRNAs) are small, non-coding RNAs that posttranscriptionally regulate gene expression via suppression of specific target mRNAs.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [5]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot
• Experiment for Drug Resistance: MTT assay; Apoptosis assay

Disease Class: Gastric cancer [ICD-11: 2B72.0] [5]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• Experiment for Molecule Alteration: miRNA microarray analysis; RT-PCR; Dual luciferase activity assay; Western blot
• Experiment for Drug Resistance: MTT assay; Apoptosis assay

References

• Ref 1: Downregulation of long noncoding RNA CRNDE suppresses drug resistance of liver cancer cells by increasing microRNA-33a expression and decreasing HMGA2 expression. Cell Cycle. 2019 Oct;18(19):2524-2537. doi: 10.1080/15384101.2019.1652035. Epub 2019 Aug 15.
• Ref 2: miR-33a is up-regulated in chemoresistant osteosarcoma and promotes osteosarcoma cell resistance to cisplatin by down-regulating TWIST. J Exp Clin Cancer Res. 2014 Jan 27;33(1):12. doi: 10.1186/1756-9966-33-12.
• Ref 3: Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.
• Ref 4: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 5: miR-181b modulates multidrug resistance by targeting BCL2 in human cancer cell lines. Int J Cancer. 2010 Dec 1;127(11):2520-9. doi: 10.1002/ijc.25260.