Molecule Information
General Information of the Molecule (ID: Mol01355)
Name |
hsa-mir-33a
,Homo sapiens
|
||||
---|---|---|---|---|---|
Synonyms |
microRNA 33a
Click to Show/Hide
|
||||
Molecule Type |
Precursor miRNA
|
||||
Gene Name |
MIR33A
|
||||
Gene ID | |||||
Location |
chr22:41900944-41901012[+]
|
||||
Sequence |
CUGUGGUGCAUUGUAGUUGCAUUGCAUGUUCUGGUGGUACCCAUGCAAUGUUUCCACAGU
GCAUCACAG Click to Show/Hide
|
||||
Ensembl ID | |||||
HGNC ID | |||||
Precursor Accession | |||||
Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Liver cancer | [1] | |||
Resistant Disease | Liver cancer [ICD-11: 2C12.6] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | BEL-7402 cells | Liver | Homo sapiens (Human) | CVCL_5492 |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | Downregulated LncRNA CRNDE could up-regulate miR-33a expression and inhibit HMGA2 expression, thus it could significantly promote apoptosis of liver cancer drug-resistant cells on different chemotherapeutic drugs (ADM, DDP, 5-FU)and inhibit its proliferation, migration, invasion and drug resistance. | |||
Disease Class: Osteosarcoma | [2] | |||
Resistant Disease | Osteosarcoma [ICD-11: 2B51.0] | |||
Resistant Drug | Cisplatin | |||
Molecule Alteration | Expression | Up-regulation |
||
Experimental Note | Identified from the Human Clinical Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
In Vitro Model | MG63 cells | Bone marrow | Homo sapiens (Human) | CVCL_0426 |
SAOS-2 cells | Bone marrow | Homo sapiens (Human) | CVCL_0548 | |
Experiment for Molecule Alteration |
qRT-PCR | |||
Experiment for Drug Resistance |
TUNEL assay | |||
Mechanism Description | miR-33a is up-regulated in chemoresistant OS and that the miR-33a level is negatively correlated with the TWIST protein level in OS. miR-33a promotes OS cell resistance to cisplatin by down-regulating TWIST. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Liver cancer | [1] | |||
Resistant Disease | Liver cancer [ICD-11: 2C12.6] | |||
Resistant Drug | Doxorubicin | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell viability | Activation | hsa05200 | ||
In Vitro Model | BEL-7402 cells | Liver | Homo sapiens (Human) | CVCL_5492 |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | Downregulated LncRNA CRNDE could up-regulate miR-33a expression and inhibit HMGA2 expression, thus it could significantly promote apoptosis of liver cancer drug-resistant cells on different chemotherapeutic drugs (ADM, DDP, 5-FU)and inhibit its proliferation, migration, invasion and drug resistance. |
Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
||||
Disease Class: Liver cancer | [1] | |||
Resistant Disease | Liver cancer [ICD-11: 2C12.6] | |||
Resistant Drug | Fluorouracil | |||
Molecule Alteration | Expression | Down-regulation |
||
Experimental Note | Revealed Based on the Cell Line Data | |||
Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
Cell proliferation | Activation | hsa05200 | ||
In Vitro Model | BEL-7402 cells | Liver | Homo sapiens (Human) | CVCL_5492 |
HepG2 cells | Liver | Homo sapiens (Human) | CVCL_0027 | |
In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
Experiment for Molecule Alteration |
RT-qPCR | |||
Experiment for Drug Resistance |
MTT assay; Flow cytometry assay | |||
Mechanism Description | Downregulated LncRNA CRNDE could up-regulate miR-33a expression and inhibit HMGA2 expression, thus it could significantly promote apoptosis of liver cancer drug-resistant cells on different chemotherapeutic drugs (ADM, DDP, 5-FU)and inhibit its proliferation, migration, invasion and drug resistance. |
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.