General Information of the Molecule (ID: Mol01355)
Name
hsa-mir-33a ,Homo sapiens
Synonyms
microRNA 33a
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR33A
Gene ID
407039
Location
chr22:41900944-41901012[+]
Sequence
CUGUGGUGCAUUGUAGUUGCAUUGCAUGUUCUGGUGGUACCCAUGCAAUGUUUCCACAGU
GCAUCACAG
    Click to Show/Hide
Ensembl ID
ENSG00000207932
HGNC ID
HGNC:31634
Precursor Accession
MI0000091
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
3 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Liver cancer [1]
Resistant Disease Liver cancer [ICD-11: 2C12.6]
Resistant Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model BEL-7402 cells Liver Homo sapiens (Human) CVCL_5492
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Downregulated LncRNA CRNDE could up-regulate miR-33a expression and inhibit HMGA2 expression, thus it could significantly promote apoptosis of liver cancer drug-resistant cells on different chemotherapeutic drugs (ADM, DDP, 5-FU)and inhibit its proliferation, migration, invasion and drug resistance.
Disease Class: Osteosarcoma [2]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
Resistant Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
TUNEL assay
Mechanism Description miR-33a is up-regulated in chemoresistant OS and that the miR-33a level is negatively correlated with the TWIST protein level in OS. miR-33a promotes OS cell resistance to cisplatin by down-regulating TWIST.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Liver cancer [1]
Resistant Disease Liver cancer [ICD-11: 2C12.6]
Resistant Drug Doxorubicin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell viability Activation hsa05200
In Vitro Model BEL-7402 cells Liver Homo sapiens (Human) CVCL_5492
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Downregulated LncRNA CRNDE could up-regulate miR-33a expression and inhibit HMGA2 expression, thus it could significantly promote apoptosis of liver cancer drug-resistant cells on different chemotherapeutic drugs (ADM, DDP, 5-FU)and inhibit its proliferation, migration, invasion and drug resistance.
Fluorouracil
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Liver cancer [1]
Resistant Disease Liver cancer [ICD-11: 2C12.6]
Resistant Drug Fluorouracil
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Cell proliferation Activation hsa05200
In Vitro Model BEL-7402 cells Liver Homo sapiens (Human) CVCL_5492
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Downregulated LncRNA CRNDE could up-regulate miR-33a expression and inhibit HMGA2 expression, thus it could significantly promote apoptosis of liver cancer drug-resistant cells on different chemotherapeutic drugs (ADM, DDP, 5-FU)and inhibit its proliferation, migration, invasion and drug resistance.
References
Ref 1 Downregulation of long noncoding RNA CRNDE suppresses drug resistance of liver cancer cells by increasing microRNA-33a expression and decreasing HMGA2 expression. Cell Cycle. 2019 Oct;18(19):2524-2537. doi: 10.1080/15384101.2019.1652035. Epub 2019 Aug 15.
Ref 2 miR-33a is up-regulated in chemoresistant osteosarcoma and promotes osteosarcoma cell resistance to cisplatin by down-regulating TWIST. J Exp Clin Cancer Res. 2014 Jan 27;33(1):12. doi: 10.1186/1756-9966-33-12.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.