Molecule Information

General Information of the Molecule (ID: Mol01354)

• Name: hsa-mir-32 ,Homo sapiens
• Synonyms: microRNA 32
• Molecule Type: Precursor miRNA
• Gene Name: MIR32
• Gene ID: 407036
• Location: chr9:109046229-109046298[-]
• Sequence:
  GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUG
  UGAUAUUUUC
• Ensembl ID: ENSG00000207698
• HGNC ID: HGNC:31631
• Precursor Accession: MI0000090

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 2 drug(s) in total

Cytarabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Myeloid leukemia [1]

• Sensitive Disease: Myeloid leukemia [ICD-11: 2A60.4]
• Sensitive Drug: Cytarabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• In Vitro Model: U937 cells; Blood; Homo sapiens (Human); CVCL_0007
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: One of the predicted targets of miR-32 lies in the 3' untranslated region (UTR) of BCL2L11 gene, which encodes the pro-apoptotic protein Bim, miR-32 blockade is sufficient to elevate Bim expression and sensitize AML cells to chemotherapy-induced apoptosis.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [2]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.

References

• Ref 1: MicroRNA-32 upregulation by 1,25-dihydroxyvitamin D3 in human myeloid leukemia cells leads to Bim targeting and inhibition of AraC-induced apoptosis. Cancer Res. 2011 Oct 1;71(19):6230-9. doi: 10.1158/0008-5472.CAN-11-1717. Epub 2011 Aug 4.
• Ref 2: miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.