Molecule Information

General Information of the Molecule (ID: Mol01354)

• Name: hsa-mir-32 ,Homo sapiens
• Synonyms: microRNA 32
• Molecule Type: Precursor miRNA
• Gene Name: MIR32
• Gene ID: 407036
• Location: chr9:109046229-109046298[-]
• Sequence:
  GGAGAUAUUGCACAUUACUAAGUUGCAUGUUGUCACGGCCUCAAUGCAAUUUAGUGUGUG
  UGAUAUUUUC
• Ensembl ID: ENSG00000207698
• HGNC ID: HGNC:31631
• Precursor Accession: MI0000090

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 10 drug(s) in total

Fluorouracil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: 5-FU cells; Colon; Homo sapiens (Human); CVCL_1846
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The miRNA expression profiles between the parental and resistant gastric cancer cells were analyzed by Human miRNA OneArray? v3 and the results were confirmed by quantitative real-time RT-PCR. The expression of 9 miRNAs (miR-10b, -22, -31, -133b, -190, -501, -615, -501-5p and -615-5p) was upregulated while the expression of 18 additional miRNAs (miR-32, -197, -210, -766, -1229, -1238, -3131, -3149, -1224-3p, -3162-3p, -532, -877, -4701-5p, -5096, -4728-3p, -1273d, -486-3p and-4763-3p) was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line. The results indicate that miRNA expression correlates with MDR in gastric cancer and may serve as biomolecular targets for MDR elimination.

Cisplatin

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [2]

• Sensitive Disease: Prostate cancer [ICD-11: 2C82.0]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: PC-3 cells; Bone; Homo sapiens (Human); CVCL_0035
• In Vitro Model: DU145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• Experiment for Molecule Alteration: RNA sequencing analysis; q-RT-PCR; Western blot; Chromatin immunoprecipitation
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Here, we found that KLF4 was induced by cisplatin in prostate cancer cells and that the increase in KLF4 promoted cell apoptosis. Further mechanistic studies revealed that KLF4 directly bound to the promoter of BIK, facilitating its transcription. Additionally, we also found that the gene encoding KLF4 was a direct target of miR-32-5p. The downregulation of miR-32-5p in response to cisplatin treatment promoted KLF4 expression, which resulted in a increase in the chemosensitivity of prostate cancer.

Cytarabine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Myeloid leukemia [ICD-11: 2A60.4] [3]

• Sensitive Disease: Myeloid leukemia [ICD-11: 2A60.4]
• Sensitive Drug: Cytarabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HL60 cells; Peripheral blood; Homo sapiens (Human); CVCL_0002
• In Vitro Model: U937 cells; Blood; Homo sapiens (Human); CVCL_0007
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: One of the predicted targets of miR-32 lies in the 3' untranslated region (UTR) of BCL2L11 gene, which encodes the pro-apoptotic protein Bim, miR-32 blockade is sufficient to elevate Bim expression and sensitize AML cells to chemotherapy-induced apoptosis.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [ICD-11: 2C10.3] [5]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [6]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: DU145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• Experiment for Molecule Alteration: Electron microscopy; Western blot; microRNA microarray chip analysis; RT-qPCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: Additionally, hub TCF4 target genes mainly regulated by upregulated miRNAs (hsa-miR-32-5p) and downregulated miRNAs (hsa-miR-141-3p, -606, -381 and -429).

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prostate cancer [ICD-11: 2C82.0] [6]

• Resistant Disease: Prostate cancer [ICD-11: 2C82.0]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K-AKT signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: Wnt signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: ErbB signalling pathway; Regulation; N.A.
• Cell Pathway Regulation: hsa05215; Regulation; N.A.
• In Vitro Model: DU145 cells; Prostate; Homo sapiens (Human); CVCL_0105
• In Vitro Model: PC3 cells; Prostate; Homo sapiens (Human); CVCL_0035
• Experiment for Molecule Alteration: Electron microscopy; Western blot; microRNA microarray chip analysis; qRT-PCR
• Experiment for Drug Resistance: Cell viability assay
• Mechanism Description: We found that hub hsa-miR3176, -141-3p, -5004-5p, -16-5p, -3915, -488-3p, -23c, -3673 and -3654 were potential targets to hub gene androgen receptor (AR) and phosphatase and tensin homolog (PTEN). Hub gene T-cell factors/lymphoid enhancer-binding factors 4 (TCF4) target genes were mainly regulated by hub hsa-miR-32-5p, -141-3p, -606, -381 and -429.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [7]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray profiling, TaqMan Reverse Transcription (RT)-PCR for miRNA Quantification
• Experiment for Drug Resistance: Cell Proliferation Assay, Apoptosis Assay
• Mechanism Description: miRNA microarray analysis of MCF-7 cell lines that are either sensitive (parental) or resistant (4-hydroxytamoxifen-resistant (OHTR)) to tamoxifen showed significant (>1.8-fold) up-regulation of eight miRNAs and marked down-regulation (>50%) of seven miRNAs in OHTRcells compared with parental MCF-7 cells.

Verapamil

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [4]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Verapamil
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: MiRNA microarray; RT-PCR; Western blot
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: MicroRNAs play important roles in regulation of gene expression involved in crucial biological processes including development, differentiation, apoptosis, and proliferation through down-regulation of target mRNA by degrading them or inhibiting their translation, and specific inhibition of MAPK signaling is important in the regulation of MCF-7/AdrVp cells resistance to chemotherapy drug.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Gastric cancer [ICD-11: 2B72.0] [1]

• Resistant Disease: Gastric cancer [ICD-11: 2B72.0]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: SGC-7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: 5-FU cells; Colon; Homo sapiens (Human); CVCL_1846
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The miRNA expression profiles between the parental and resistant gastric cancer cells were analyzed by Human miRNA OneArray? v3 and the results were confirmed by quantitative real-time RT-PCR. The expression of 9 miRNAs (miR-10b, -22, -31, -133b, -190, -501, -615, -501-5p and -615-5p) was upregulated while the expression of 18 additional miRNAs (miR-32, -197, -210, -766, -1229, -1238, -3131, -3149, -1224-3p, -3162-3p, -532, -877, -4701-5p, -5096, -4728-3p, -1273d, -486-3p and-4763-3p) was downregulated in the SGC-7901/5-Fu cell line compared with its parental cell line. The results indicate that miRNA expression correlates with MDR in gastric cancer and may serve as biomolecular targets for MDR elimination.

References

• Ref 1: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 2: Molecular Basis for Necitumumab Inhibition of EGFR Variants Associated with Acquired Cetuximab ResistanceMol Cancer Ther. 2018 Feb;17(2):521-531. doi: 10.1158/1535-7163.MCT-17-0575. Epub 2017 Nov 20.
• Ref 3: MicroRNA-32 upregulation by 1,25-dihydroxyvitamin D3 in human myeloid leukemia cells leads to Bim targeting and inhibition of AraC-induced apoptosis. Cancer Res. 2011 Oct 1;71(19):6230-9. doi: 10.1158/0008-5472.CAN-11-1717. Epub 2011 Aug 4.
• Ref 4: The role of p-glycoprotein in limiting brain penetration of the peripherally acting anticholinergic overactive bladder drug trospium chloride. Drug Metab Dispos. 2009 Jul;37(7):1371-4. doi: 10.1124/dmd.109.027144. Epub 2009 Apr 23.
• Ref 5: miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
• Ref 6: Intermittent High-Dose Scheduling of AZD8835, a Novel Selective Inhibitor of PI3KAlpha and PI3K Delta, Demonstrates Treatment Strategies for PIK3CA-Dependent Breast CancersMol Cancer Ther. 2016 May;15(5):877-89. doi: 10.1158/1535-7163.MCT-15-0687. Epub 2016 Feb 2.
• Ref 7: MicroRNA-221/222 confers tamoxifen resistance in breast cancer by targeting p27Kip1. J Biol Chem. 2008 Oct 31;283(44):29897-903. doi: 10.1074/jbc.M804612200. Epub 2008 Aug 15.