General Information of the Molecule (ID: Mol01348)
Name
hsa-mir-26a ,Homo sapiens
Synonyms
microRNA 26a-1
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR26A1
Gene ID
407015
Location
chr3:37969404-37969480[+]
Sequence
GUGGCCUCGUUCAAGUAAUCCAGGAUAGGCUGUGCAGGUCCCAAUGGGCCUAUUCUUGGU
UACUUGCACGGGGACGC
    Click to Show/Hide
Ensembl ID
ENSG00000199075
HGNC ID
HGNC:31610
Precursor Accession
MI0000083
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
Click to Show/Hide the Full List of Drugs
Cisplatin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Glioblastoma [1]
Sensitive Disease Glioblastoma [ICD-11: 2A00.02]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell autophagy Inhibition hsa04140
miR26a/GSk3Beta/Mcl1 signaling pathway Regulation hsa05206
In Vitro Model U251-MG cells Brain Homo sapiens (Human) CVCL_0021
U87MG cells Brain Homo sapiens (Human) CVCL_GP63
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay; Annexin V-FITC staining assay; Flow cytometry assay
Mechanism Description Long non-coding RNA AC023115.3 suppresses chemoresistance of glioblastoma by reducing autophagy. AC023115.3 acts as a competing endogenous RNA for miR26a and attenuates the inhibitory effect of miR26a on GSk3beta, leading to an increase in GSk3beta and a decrease in autophagy.
Disease Class: Non-small cell lung cancer [2]
Sensitive Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
HMGA2-E2F1-AKT signaling pathway Inhibition hsa05206
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay; Flow cytometry assay
Mechanism Description Decreased MicroRNA-26a expression significantly decreased the expression of E2F1, diminished Akt phosphorylation, and downregulated Bcl2 expression, which causes cisplatin resistance in human non-small cell lung cancer.
Disease Class: Gastric cancer [3]
Sensitive Disease Gastric cancer [ICD-11: 2B72.1]
Sensitive Drug Cisplatin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell proliferation Inhibition hsa05200
In Vitro Model SGC7901 cells Gastric Homo sapiens (Human) CVCL_0520
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTS assay
Mechanism Description NRAS and E2F2 as the direct targets of miR-26a were further confirmed in luciferase activity assays and miR-26a-mediated these two genes expression analysis. Our results also found that knockdown of NRAS or E2F2 sensitize GC cells to cisplatin. miR-26a overexpression has been demonstrated to improve the sensitivity of GC cells to cisplatin and this effect was considered to be mediated via its targets NRAS and E2F2.
Doxorubicin
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Hepatocellular carcinoma [4]
Sensitive Disease Hepatocellular carcinoma [ICD-11: 2C12.2]
Sensitive Drug Doxorubicin
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
In Vitro Model Huh-7 cells Liver Homo sapiens (Human) CVCL_0336
HepG2 cells Liver Homo sapiens (Human) CVCL_0027
293T cells Breast Homo sapiens (Human) CVCL_0063
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
CCK8 assay
Mechanism Description miR26a/b can promote apoptosis and sensitize HCC to chemotherapy via suppressing the expression of autophagy initiator ULk.
Gefitinib
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Non-small cell lung cancer [5]
Resistant Disease Non-small cell lung cancer [ICD-11: 2C25.Y]
Resistant Drug Gefitinib
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
EGFR signaling pathway Activation hsa01521
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
SPC-A1 cells Lung Homo sapiens (Human) CVCL_6955
PC9 cells Lung Homo sapiens (Human) CVCL_B260
NCI-H520 cells Lung Homo sapiens (Human) CVCL_1566
H2170 cells Lung Homo sapiens (Human) CVCL_1535
SW900 cells Lung Homo sapiens (Human) CVCL_1731
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description miR-26a desensitizes non-small cell lung cancer cells to tyrosine kinase inhibitors by targeting and reducing the level of PTPN1.
Paclitaxel
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [6]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Paclitaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
Cell viability Inhibition hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
MDA-MB-468 cells Breast Homo sapiens (Human) CVCL_0419
MCF10A cells Breast Homo sapiens (Human) CVCL_0598
MDA-MB-435 cells Breast Homo sapiens (Human) CVCL_0417
184A1 cells Breast Homo sapiens (Human) CVCL_3040
Experiment for
Molecule Alteration
qRT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description MCL-1(myeloid cell leukemia 1), a pro-survival member of the Bcl-2(B-cell CLL/lymphoma 2) family, several miRNAs induces apoptosis by targeting MCL-1, miR-26a Inhibits MCL-1 expression, increased sensitivity of breast cancer cells to paclitaxel.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [7]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
Resistant Drug Tamoxifen
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell viability Activation hsa05200
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
T47D cells Breast Homo sapiens (Human) CVCL_0553
BT474 cells Breast Homo sapiens (Human) CVCL_0179
Hs-578T cells Breast Homo sapiens (Human) CVCL_0332
Experiment for
Molecule Alteration
RT-qPCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description Both miR-26a knockdown and E2F7 overexpression conferred resistance to TAM in MCF-7 cells and there is an inverse correlation between miR-26a and E2F7 expression.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [8]
Sensitive Disease Breast cancer [ICD-11: 2C60.3]
Sensitive Drug Tamoxifen
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
T47D cells Breast Homo sapiens (Human) CVCL_0553
MCF7/TAMR cells Breast Homo sapiens (Human) CVCL_EG55
T47D/TAMR cells Breast Homo sapiens (Human) CVCL_1D36
Experiment for
Molecule Alteration
RT-PCR
Experiment for
Drug Resistance
MTT assay
Mechanism Description The ERBB2 expression is regulated at the post-transcriptional level by miR26a/b and the RNA-binding protein human antigen R, miR26a/b inhibits the translation of ERBB2 mRNA, whereas HuR enhances the stability of the ERBB2 mRNA.
References
Ref 1 Long non-coding RNA AC023115.3 suppresses chemoresistance of glioblastoma by reducing autophagy. Biochim Biophys Acta Mol Cell Res. 2017 Aug;1864(8):1393-1404. doi: 10.1016/j.bbamcr.2017.05.008. Epub 2017 May 9.
Ref 2 Decreased MicroRNA-26a expression causes cisplatin resistance in human non-small cell lung cancer. Cancer Biol Ther. 2016 May 3;17(5):515-25. doi: 10.1080/15384047.2015.1095405. Epub 2015 Oct 22.
Ref 3 MiR-26a enhances the sensitivity of gastric cancer cells to cisplatin by targeting NRAS and E2F2. Saudi J Gastroenterol. 2015 Sep-Oct;21(5):313-9. doi: 10.4103/1319-3767.166206.
Ref 4 MiR-26 enhances chemosensitivity and promotes apoptosis of hepatocellular carcinoma cells through inhibiting autophagy. Cell Death Dis. 2017 Jan 12;8(1):e2540. doi: 10.1038/cddis.2016.461.
Ref 5 miR-26a desensitizes non-small cell lung cancer cells to tyrosine kinase inhibitors by targeting PTPN13. Oncotarget. 2016 Jul 19;7(29):45687-45701. doi: 10.18632/oncotarget.9920.
Ref 6 MiR-26a inhibits proliferation and migration of breast cancer through repression of MCL-1. PLoS One. 2013 Jun 4;8(6):e65138. doi: 10.1371/journal.pone.0065138. Print 2013.
Ref 7 A miR-26a/E2F7 feedback loop contributes to tamoxifen resistance in ER-positive breast cancer. Int J Oncol. 2018 Oct;53(4):1601-1612. doi: 10.3892/ijo.2018.4492. Epub 2018 Jul 19.
Ref 8 Post-transcriptional regulation of ERBB2 by miR26a/b and HuR confers resistance to tamoxifen in estrogen receptor-positive breast cancer cells. J Biol Chem. 2017 Aug 18;292(33):13551-13564. doi: 10.1074/jbc.M117.780973. Epub 2017 Jun 21.
insuranceusa.com
visits since 2022

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.