Molecule Information

General Information of the Molecule (ID: Mol01338)

• Name: hsa-mir-17 ,Homo sapiens
• Synonyms: microRNA 17
• Molecule Type: Precursor miRNA
• Gene Name: MIR17
• Gene ID: 406952
• Location: chr13:91350605-91350688[+]
• Sequence:
  GUCAGAAUAAUGUCAAAGUGCUUACAGUGCAGGUAGUGAUAUGUGCAUCUACUGCAGUGA
  AGGCACUUGUAGCAUUAUGGUGAC
• Ensembl ID: ENSG00000284536
• HGNC ID: HGNC:31547
• Precursor Accession: MI0000071

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 16 drug(s) in total

Bromocriptine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Prolactin-secreting adenoma [ICD-11: 2F37.Y] [2]

• Resistant Disease: Prolactin-secreting adenoma [ICD-11: 2F37.Y]
• Resistant Drug: Bromocriptine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: KHM-5M cells; Pleural effusion; Homo sapiens (Human); CVCL_2975
• Experiment for Molecule Alteration: Solexa sequencing assay; qRT-PCR
• Experiment for Drug Resistance: Clinical diagnostic evaluation
• Mechanism Description: Hsa-mir-93, hsa-mir-17, hsa-mir-22*, hsa-mir-126*, hsa-mir-142-3p, hsa-mir-144*, hsa-mir-486-5p, hsa-mir-451, and hsa-mir-92a were up-regulated and hsa-mir-30a, hsa-mir-382, and hsa-mir-136 were down-regulated in bromocriptine-resistant prolactinomas in comparison with bromocriptine-sensitive prolactinomas.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Laryngeal squamous cell carcinoma [ICD-11: 2C23.10] [3]

• Resistant Disease: Laryngeal squamous cell carcinoma [ICD-11: 2C23.10]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell autophagy; Activation; hsa04140
• Cell Pathway Regulation: miR17/ATG7 signaling pathway; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: LncRNA BLACAT1 Can enhance ATG7 expression by suppressing miR-17 expression to promote autophagy and cisplatin resistance in non small cell lung cancer through the miR-17/ATG7 signaling pathway.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.Y] [4]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: TGF-beta signaling pathway; Activation; hsa04350
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8-8 assay; Transwell migration assay; Promega assay
• Mechanism Description: miR-17, 20a, 20b were down-regulation in cisplatin-resistant A549/DDP cells compared with A549 cells. inhibition of miR-17, 20a, 20b increased cisplatin-resistant and migration of A549 cells, and over-expression of miR-17, 20a, 20b decreased cisplatin-resistant and migration of A549/DDP cells. miR-17, 20a, 20b blunted the TGFbeta signal pathway by directly inhibiting its important component TGFbetaR2. TGFbetaR2 silenced led to cisplatin sensitivity and migration inhibition in A549/DDP cells.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Laryngeal squamous cell carcinoma [ICD-11: 2C23.10] [5]

• Sensitive Disease: Laryngeal squamous cell carcinoma [ICD-11: 2C23.10]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell autophagy; Activation; hsa04140
• Cell Pathway Regulation: lncRNA-XIST/miR17 axis; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: Knockdown of LncRNA-XIST enhances the chemosensitivity of NSCLC cells via suppression of autophagy. LncRNA-XIST inhibits the expression of miR17 to modulate ATG7 and LncRNA-XIST regulates autophagy through ATG7.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [6]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: The inhibition of miR-17 may have tumor suppressive effects on GC and enhance its chemosensitivity by promoting DEDD, impairing EMT in GC cells.

Dasatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [7]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Dasatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: The results revealed significant increase in the ex pression levels of miR-17 in imatinib sensitive and resistant cells compared to peripheral blood mononuclear cells (PB MCs). On the other hand, significant decrease was observed in miR-17 levels in response to imatinib, nilotinib and dasatinib.

Docetaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Neuroblastoma [ICD-11: 2A00.02] [7]

• Resistant Disease: Neuroblastoma [ICD-11: 2A00.02]
• Resistant Drug: Docetaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: U87 cells; Brain; Homo sapiens (Human); CVCL_0022
• Experiment for Molecule Alteration: Western blot; Luciferase activity assay
• Experiment for Drug Resistance: Cell function test; Cell migration assay; Flow cytometry assay; Colony formation and self-renewal assay; MTT assay
• Mechanism Description: We have demonstrated that glioblastoma cells deprived of nutrition or treated with chemotherapeutics drugs expressed increased levels of miR-17

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Synovial sarcoma [ICD-11: 2B5A.0] [8]

• Resistant Disease: Synovial sarcoma [ICD-11: 2B5A.0]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: p21; Regulation; N.A.
• In Vitro Model: HS-SYII cells; Sarcoma; Homo sapiens (Human); CVCL_8719
• In Vitro Model: SYO-1 cells; Sarcoma; Homo sapiens (Human); CVCL_7146
• In Vitro Model: Fuji cells; Sarcoma; Homo sapiens (Human); CVCL_D880
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Colony formation assay
• Mechanism Description: Overexpression of miR-17 in synovial sarcoma cells, Fuji and HS-SYII, increased colony forming ability in addition to cell growth, but not cell motility and invasion. Tumor volume formed in mice in vivo was significantly increased by miR-17 overexpression with a marked increase of MIB-1 index. According to PicTar and Miranda algorithms, which predicted CDkN1A (p21) as a putative target of miR-17, a luciferase assay was performed and revealed that miR-17 directly targets the 3'-UTR of p21 mRNA. Indeed, p21 protein level was remarkably decreased by miR-17 overexpression in a p53-independent manner. It is noteworthy that miR-17 succeeded in suppressing doxorubicin-evoked higher expression of p21 and conferred the drug resistance. Meanwhile, introduction of anti-miR-17 in Fuji and HS-SYII cells significantly decreased cell growth, consistent with rescued expression of p21.

Etoposide

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [9]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: MRP-1/ABCC1; Regulation; N.A.
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• Experiment for Molecule Alteration: RT-PCR; qRT-PCR; Luciferase reporter assay; Western blot; Immunofluorescence staining
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: Seventeen of miRNAs were differentially expressed in MCF-7/VP cells and their parent cells. The majority of these miRNAs exhibited increased expression levels, while miR-326, miR-429, miR-187, miR-7, and miR-92-2 showed decreased expression.

Fluorouracil

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Gastric cancer [ICD-11: 2B72.1] [6]

• Sensitive Disease: Gastric cancer [ICD-11: 2B72.1]
• Sensitive Drug: Fluorouracil
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SGC7901 cells; Gastric; Homo sapiens (Human); CVCL_0520
• In Vitro Model: BGC823 cells; Gastric; Homo sapiens (Human); CVCL_3360
• In Vitro Model: AGS cells; Gastric; Homo sapiens (Human); CVCL_0139
• In Vitro Model: HGC27 cells; Gastric; Homo sapiens (Human); CVCL_1279
• In Vitro Model: MkN-45 cells; Gastric; Homo sapiens (Human); CVCL_0434
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: The inhibition of miR-17 may have tumor suppressive effects on GC and enhance its chemosensitivity by promoting DEDD, impairing EMT in GC cells.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Bladder cancer [ICD-11: 2C94.0] [10]

• Resistant Disease: Bladder cancer [ICD-11: 2C94.0]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: J82 cells; Bladder; Homo sapiens (Human); CVCL_0359
• In Vitro Model: UM-UC-3 cells; Bladder; Homo sapiens (Human); CVCL_1783
• In Vitro Model: RT4 cells; Bladder; Homo sapiens (Human); CVCL_0036
• In Vitro Model: RT112 cells; Bladder; Homo sapiens (Human); CVCL_1670
• Experiment for Molecule Alteration: Western blot; Microarray Analysis; qRT-PCR
• Experiment for Drug Resistance: Proliferation Assay
• Mechanism Description: Within this group, let-7b and let-7i exhibited decreased expression, while miR-1290 and miR-138 displayed increased expression levels in gemcitabine-resistant cells

Imatinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [7]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Imatinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: The results revealed significant increase in the ex pression levels of miR-17 in imatinib sensitive and resistant cells compared to peripheral blood mononuclear cells (PB MCs). On the other hand, significant decrease was observed in miR-17 levels in response to imatinib, nilotinib and dasatinib.

Irinotecan

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [11]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Irinotecan
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Colorectal cancer cells; Colon; Homo sapiens (Human); N.A.
• In Vivo Model: Colorectal cancer patients blood samples; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: Of note, Despotovic et al. suggested that miR-17-5p could serve as a candidate biomarker via the regulation of the TGF-beta Signaling pathway for monitoring the response to FOLFIRI in mCRC patients.

Nilotinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Chronic myeloid leukemia [ICD-11: 2A20.0] [7]

• Resistant Disease: Chronic myeloid leukemia [ICD-11: 2A20.0]
• Resistant Drug: Nilotinib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: K562 cells; Blood; Homo sapiens (Human); CVCL_0004
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: The results revealed significant increase in the ex pression levels of miR-17 in imatinib sensitive and resistant cells compared to peripheral blood mononuclear cells (PB MCs). On the other hand, significant decrease was observed in miR-17 levels in response to imatinib, nilotinib and dasatinib.

Oxaliplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [ICD-11: 2B91.1] [11]

• Resistant Disease: Colorectal cancer [ICD-11: 2B91.1]
• Resistant Drug: Oxaliplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT signalling pathway; Regulation; N.A.
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Flow cytometry
• Mechanism Description: The aim of this study was to analyze the effect of chemotherapy for mCRC on TGF-beta signaling and related miRNAs. Hsa-miR-17-5p, hsa-miR-21-5p and hsa-miR-93-5p were selected out of 316 miRNAs with multiple targets within the TGF-beta signaling by in silico analysis. SW620 cells were treated with chemotherapeutic drugs for mCRC for 1, 3 and 6 days and expression of selected miRNAs, PAI-1, CDH1 and VIM was measured. Expression of TGF-beta signaling-related hsa-miR-17-5p, hsa-miR-21-5p and hsa-miR-93-5p was time-dependently altered in SW620 cells treated with chemotherapeutics for mCRC. The expression of hsa-miR-93-5p remained downregulated after 6 days under combined treatments FOX and FIRI as well as the hsa-miR-17-5p expression under FIRI. Chemotherapy regimens for mCRC increased expression of a major TGF-beta signaling target gene PAI-1, independently of the selected miRNAs expression. These treatments also increased the expression of epithelial-mesenchymal transition (EMT) markers CDH1 and VIM on day 3 resulting in decrease of mesenchymal-like characteristics. However, their expression returned close to basal level on day 6. In conclusion, after initial response to chemotherapeutic drugs SW620 cells start to return close to the basal mesenchymal state while the long-term downregulated expression pattern of hsa-miR-93-5p and hsa-miR-17-5p makes them candidates worth testing as biomarkers for monitoring combined chemotherapeutic treatments therapy response in mCRC patients.

Paclitaxel

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.3] [12]

• Resistant Disease: Breast cancer [ICD-11: 2C60.3]
• Resistant Drug: Paclitaxel
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: MDA-MB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MCF-7/Tax1 cells; Breast; Homo sapiens (Human); CVCL_IJ26
• In Vitro Model: MCF-7/Tax2 cells; Breast; Homo sapiens (Human); CVCL_IJ26
• In Vitro Model: MDA-MB-231/Tax1 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vitro Model: MDA-MB-231/Tax2 cells; Breast; Homo sapiens (Human); CVCL_0062
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; Annexin-V-FITC (fluorescein isothiocyanate)/PI (propidium iodide) analysis
• Mechanism Description: Decreased expression of microRNA-17 and microRNA-20b promotes breast cancer resistance to taxol therapy by upregulation of NCOA3.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [ICD-11: 2C25.5] [13]

• Sensitive Disease: Lung cancer [ICD-11: 2C25.5]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: PI3K/AKT/mTOR signaling pathway; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H1299 cells; Lung; Homo sapiens (Human); CVCL_0060
• In Vitro Model: NCl-H596 cells; Lung; Homo sapiens (Human); CVCL_1571
• In Vitro Model: NCI-H1734 cells; Lung; Homo sapiens (Human); CVCL_1491
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-16 was also significantly downregulated in paclitaxel resistant lung cancer cells. anti-apoptotic protein Bcl-2 was directly targeted miR-16 in paclitaxel resistant lung cancer cells. the combined overexpression of miR-16 and miR-17 and subsequent paclitaxel treatment greatly sensitized paclitaxel resistant lung cancer cells to paclitaxel by inducing apoptosis via caspase-3 mediated pathway. Combined overexpression of miR-16 and miR-17 greatly reduced Beclin-1 and Bcl-2 expressions respectively. though miR-17 and miR-16 had no common target, both miR-16 and miR-17 jointly played roles in the development of paclitaxel resistance in lung cancer. miR-17 overexpression reduced cytoprotective autophagy by targeting Beclin-1, whereas overexpression of miR-16 potentiated paclitaxel induced apoptotic cell death by inhibiting anti-apoptotic protein Bcl-2.

Sirolimus

Drug Sensitive Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Malignant glioma [ICD-11: 2A00.02] [7]

• Sensitive Disease: Malignant glioma [ICD-11: 2A00.02]
• Sensitive Drug: Sirolimus
• Molecule Alteration: Expression; Down-regulation
• Mechanism Description: Downregulation of Myc or inhibition of miR-19 or miR-17 which share seed sequences with other members of the miR-17-92 cluster, restored the sensitivity of RR1 cells to rapamycin, suggesting that the miR-17-92 cluster may mediate Myc-induced resistance to rapamycin.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [14]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

Temozolomide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Glioblastoma [ICD-11: 2A00.02] [15]

• Sensitive Disease: Glioblastoma [ICD-11: 2A00.02]
• Sensitive Drug: Temozolomide
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell autophagy; Activation; hsa04140
• In Vitro Model: T98G cells; Brain; Homo sapiens (Human); CVCL_0556
• In Vitro Model: U373-MG; Brain; Homo sapiens (Human); CVCL_2219
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Celltiter 96 aqueous one solution cell proliferation assay
• Mechanism Description: ATG7 is a potential target for miR-17, and this miRNA could negatively regulate ATG7 expression, resulting in a modulation of the autophagic status in T98G glioblastoma cells, the autophagy activation by anti-miR-17 resulted in a decrease of the threshold resistance at temozolomide doses in T98G cells.

References

• Ref 1: Protein kinase C inhibitor AEB071 targets ocular melanoma harboring GNAQ mutations via effects on the PKC/Erk1/2 and PKC/NF-kB pathwaysMol Cancer Ther. 2012 Sep;11(9):1905-14. doi: 10.1158/1535-7163.MCT-12-0121. Epub 2012 May 31.
• Ref 2: MicroRNA expression profile of bromocriptine-resistant prolactinomas .Mol Cell Endocrinol. 2014 Sep;395(1-2):10-8. doi: 10.1016/j.mce.2014.07.014. Epub 2014 Jul 23. 10.1016/j.mce.2014.07.014
• Ref 3: LncRNA BLACAT1 is involved in chemoresistance of non small cell lung cancer cells by regulating autophagy. Int J Oncol. 2019 Jan;54(1):339-347. doi: 10.3892/ijo.2018.4614. Epub 2018 Oct 31.
• Ref 4: MiRNA 17 family regulates cisplatin-resistant and metastasis by targeting TGFbetaR2 in NSCLC. PLoS One. 2014 Apr 10;9(4):e94639. doi: 10.1371/journal.pone.0094639. eCollection 2014.
• Ref 5: Knockdown of lncRNA-XIST enhances the chemosensitivity of NSCLC cells via suppression of autophagy. Oncol Rep. 2017 Dec;38(6):3347-3354. doi: 10.3892/or.2017.6056. Epub 2017 Oct 24.
• Ref 6: MicroRNA-17 inhibition overcomes chemoresistance and suppresses epithelial-mesenchymal transition through a DEDD-dependent mechanism in gastric cancer. Int J Biochem Cell Biol. 2018 Sep;102:59-70. doi: 10.1016/j.biocel.2018.06.007. Epub 2018 Jun 25.
• Ref 7: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.
• Ref 8: SS18-SSX-regulated miR-17 promotes tumor growth of synovial sarcoma by inhibiting p21WAF1/CIP1. Cancer Sci. 2014 Sep;105(9):1152-9. doi: 10.1111/cas.12479. Epub 2014 Sep 3.
• Ref 9: Involvement of miR-326 in chemotherapy resistance of breast cancer through modulating expression of multidrug resistance-associated protein 1. Biochem Pharmacol. 2010 Mar 15;79(6):817-24. doi: 10.1016/j.bcp.2009.10.017. Epub 2009 Oct 31.
• Ref 10: The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
• Ref 11: Indian J Med Paediatr Oncol. 2015 Apr-Jun;36(2):133-6. doi: 10.4103/0971-5851.158852.
• Ref 12: Decreased expression of microRNA-17 and microRNA-20b promotes breast cancer resistance to taxol therapy by upregulation of NCOA3. Cell Death Dis. 2016 Nov 10;7(11):e2463. doi: 10.1038/cddis.2016.367.
• Ref 13: MiR-16 targets Bcl-2 in paclitaxel-resistant lung cancer cells and overexpression of miR-16 along with miR-17 causes unprecedented sensitivity by simultaneously modulating autophagy and apoptosis. Cell Signal. 2015 Feb;27(2):189-203. doi: 10.1016/j.cellsig.2014.11.023. Epub 2014 Nov 27.
• Ref 14: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 15: microRNA-17 regulates the expression of ATG7 and modulates the autophagy process, improving the sensitivity to temozolomide and low-dose ionizing radiation treatments in human glioblastoma cells. Cancer Biol Ther. 2013 Jul;14(7):574-86. doi: 10.4161/cbt.24597. Epub 2013 May 10.