Molecule Information

General Information of the Molecule (ID: Mol01334)

• Name: hsa-mir-15 ,Homo sapiens
• Synonyms: microRNA 15a
• Molecule Type: Precursor miRNA
• Gene Name: MIR15A
• Gene ID: 406948
• Location: chr13:50049119-50049201[-]
• Sequence:
  CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAU
  UGUGCUGCCUCAAAAAUACAAGG
• Ensembl ID: ENSG00000283785
• HGNC ID: HGNC:31543
• Precursor Accession: MI0000069

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 5 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Epidermoid carcinoma [1]

• Sensitive Disease: Epidermoid carcinoma [ICD-11: 2C31.Z]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: KB-3-1 cells; Lung; Homo sapiens (Human); CVCL_2088
• In Vitro Model: KB-CP.5 cells; Lung; Homo sapiens (Human); CVCL_IP04
• In Vitro Model: KB-CP20 cells; Lung; Homo sapiens (Human); CVCL_IP06
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Overexpression of the cell cycle kinases WEE1 and CHk1 occurred commonly in cisplatin-resistant cells, miR-15/16/195/424/497 family sensitize cisplatin-resistant cells to apoptosis by targeting WEE1 and CHk1.

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Breast cancer [2]

• Sensitive Disease: Breast cancer [ICD-11: 2C60.3]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: BT549 cells; Breast; Homo sapiens (Human); CVCL_1092
• In Vitro Model: MDAMB-231 cells; Breast; Homo sapiens (Human); CVCL_0062
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: TUNEL assay; BrdU assay; MTT assay
• Mechanism Description: Overexpressing miR-15a sensitizes MDAMB-231 cells to the chemotherapeutic drug cisplatin via inhibiting BMI1 and downregulating MET.

Dexamethasone

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Multiple myeloma [3]

• Resistant Disease: Multiple myeloma [ICD-11: 2A83.0]
• Resistant Drug: Dexamethasone
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: Flow cytometry assay
• Mechanism Description: microRNA-15a and -16 expressions tightly correlated with proliferation and drug sensitivity of MM cells. miRNA-15a/-16 expression in MM cells was significantly increased after treatment with cytotoxic agents. The interaction of bone marrow stromal cells (BMSC) with MM cells resulted in decreased miRNA-15a/-16 expression and promoted the survival of the MM cells.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [4]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colorectal cancer [5]

• Sensitive Disease: Colorectal cancer [ICD-11: 2B91.1]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• In Vitro Model: SW620 cells; Colon; Homo sapiens (Human); CVCL_0547
• In Vitro Model: HCT116 cells; Colon; Homo sapiens (Human); CVCL_0291
• In Vitro Model: LOVO cells; Colon; Homo sapiens (Human); CVCL_0399
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: Inhibition of LINC00473 in vivo could overcome the Taxol resistance of CRC cells, could recover the expression of tumor suppressor miR-15a and chemotherapy-induced tumor regression while the BCL-2-related anti-apoptosis pathway was activated and the multidrug-resistant (MDR) genes LRP, MDR1 were up-regulated by LINC00473.

Vincristine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Colon cancer [6]

• Sensitive Disease: Colon cancer [ICD-11: 2B90.1]
• Sensitive Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• In Vitro Model: HCT8 cells; Colon; Homo sapiens (Human); CVCL_2478
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay
• Mechanism Description: miR-15a and Mir-16 reverse drug resistance in colon cancer cells, possibly by down-regulating the expression of Bcl-2 protein.

References

• Ref 1: Cisplatin sensitivity mediated by WEE1 and CHK1 is mediated by miR-155 and the miR-15 family. Cancer Res. 2012 Nov 15;72(22):5945-55. doi: 10.1158/0008-5472.CAN-12-1400. Epub 2012 Aug 31.
• Ref 2: Regulating BMI1 expression via miRNAs promote Mesenchymal to Epithelial Transition (MET) and sensitizes breast cancer cell to chemotherapeutic drug. PLoS One. 2018 Feb 2;13(2):e0190245. doi: 10.1371/journal.pone.0190245. eCollection 2018.
• Ref 3: Suppressing miRNA-15a/-16 expression by interleukin-6 enhances drug-resistance in myeloma cells. J Hematol Oncol. 2011 Sep 22;4:37. doi: 10.1186/1756-8722-4-37.
• Ref 4: miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
• Ref 5: LINC00473 promotes the Taxol resistance via miR-15a in colorectal cancer. Biosci Rep. 2018 Sep 20;38(5):BSR20180790. doi: 10.1042/BSR20180790. Print 2018 Oct 31.
• Ref 6: [miR-15a and miR-16 modulate drug resistance by targeting bcl-2 in human colon cancer cells]. Zhonghua Zhong Liu Za Zhi. 2014 Dec;36(12):897-902.