Molecule Information
General Information of the Molecule (ID: Mol01334)
| Name |
hsa-mir-15
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Synonyms |
microRNA 15a
Click to Show/Hide
|
||||
| Molecule Type |
Precursor miRNA
|
||||
| Gene Name |
MIR15A
|
||||
| Gene ID | |||||
| Location |
chr13:50049119-50049201[-]
|
||||
| Sequence |
CCUUGGAGUAAAGUAGCAGCACAUAAUGGUUUGUGGAUUUUGAAAAGGUGCAGGCCAUAU
UGUGCUGCCUCAAAAAUACAAGG Click to Show/Hide
|
||||
| Ensembl ID | |||||
| HGNC ID | |||||
| Precursor Accession | |||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
5 drug(s) in total
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Epidermoid carcinoma [ICD-11: 2C31.Z] | [1] | |||
| Sensitive Disease | Epidermoid carcinoma [ICD-11: 2C31.Z] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | KB-3-1 cells | Lung | Homo sapiens (Human) | CVCL_2088 |
| KB-CP.5 cells | Lung | Homo sapiens (Human) | CVCL_IP04 | |
| KB-CP20 cells | Lung | Homo sapiens (Human) | CVCL_IP06 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Overexpression of the cell cycle kinases WEE1 and CHk1 occurred commonly in cisplatin-resistant cells, miR-15/16/195/424/497 family sensitize cisplatin-resistant cells to apoptosis by targeting WEE1 and CHk1. | |||
|
|
||||
| Disease Class: Breast cancer [ICD-11: 2C60.3] | [2] | |||
| Sensitive Disease | Breast cancer [ICD-11: 2C60.3] | |||
| Sensitive Drug | Cisplatin | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell proliferation | Inhibition | hsa05200 | ||
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | BT549 cells | Breast | Homo sapiens (Human) | CVCL_1092 |
| MDAMB-231 cells | Breast | Homo sapiens (Human) | CVCL_0062 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
TUNEL assay; BrdU assay; MTT assay | |||
| Mechanism Description | Overexpressing miR-15a sensitizes MDAMB-231 cells to the chemotherapeutic drug cisplatin via inhibiting BMI1 and downregulating MET. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Multiple myeloma [ICD-11: 2A83.0] | [3] | |||
| Resistant Disease | Multiple myeloma [ICD-11: 2A83.0] | |||
| Resistant Drug | Dexamethasone | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| Cell Pathway Regulation | Cell apoptosis | Inhibition | hsa04210 | |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
Flow cytometry assay | |||
| Mechanism Description | microRNA-15a and -16 expressions tightly correlated with proliferation and drug sensitivity of MM cells. miRNA-15a/-16 expression in MM cells was significantly increased after treatment with cytotoxic agents. The interaction of bone marrow stromal cells (BMSC) with MM cells resulted in decreased miRNA-15a/-16 expression and promoted the survival of the MM cells. | |||
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Pancreatic cancer [ICD-11: 2C10.3] | [4] | |||
| Resistant Disease | Pancreatic cancer [ICD-11: 2C10.3] | |||
| Resistant Drug | Gemcitabine | |||
| Molecule Alteration | Expression | Down-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vitro Model | MIA PaCa-2 cells | Pancreas | Homo sapiens (Human) | CVCL_0428 |
| Experiment for Molecule Alteration |
RT-PCR | |||
| Experiment for Drug Resistance |
MTT assay | |||
| Mechanism Description | Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colorectal cancer [ICD-11: 2B91.1] | [5] | |||
| Sensitive Disease | Colorectal cancer [ICD-11: 2B91.1] | |||
| Sensitive Drug | Paclitaxel | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| Cell invasion | Inhibition | hsa05200 | ||
| Cell migration | Inhibition | hsa04670 | ||
| Cell viability | Inhibition | hsa05200 | ||
| In Vitro Model | SW620 cells | Colon | Homo sapiens (Human) | CVCL_0547 |
| HCT116 cells | Colon | Homo sapiens (Human) | CVCL_0291 | |
| LOVO cells | Colon | Homo sapiens (Human) | CVCL_0399 | |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
qRT-PCR | |||
| Experiment for Drug Resistance |
CCK8 assay; Flow cytometry assay | |||
| Mechanism Description | Inhibition of LINC00473 in vivo could overcome the Taxol resistance of CRC cells, could recover the expression of tumor suppressor miR-15a and chemotherapy-induced tumor regression while the BCL-2-related anti-apoptosis pathway was activated and the multidrug-resistant (MDR) genes LRP, MDR1 were up-regulated by LINC00473. | |||
| Drug Sensitivity Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Colon cancer [ICD-11: 2B90.1] | [6] | |||
| Sensitive Disease | Colon cancer [ICD-11: 2B90.1] | |||
| Sensitive Drug | Vincristine | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Revealed Based on the Cell Line Data | |||
| Cell Pathway Regulation | Cell apoptosis | Activation | hsa04210 | |
| In Vitro Model | HCT8 cells | Colon | Homo sapiens (Human) | CVCL_2478 |
| In Vivo Model | Nude mouse xenograft model | Mus musculus | ||
| Experiment for Molecule Alteration |
RT-qPCR | |||
| Experiment for Drug Resistance |
CCK8 assay | |||
| Mechanism Description | miR-15a and Mir-16 reverse drug resistance in colon cancer cells, possibly by down-regulating the expression of Bcl-2 protein. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
