Molecule Information

General Information of the Molecule (ID: Mol01761)

Name	hsa-miR-3163 ,Homo sapiens
Synonyms	microRNA 3163 Click to Show/Hide
Molecule Type	Mature miRNA
Sequence	UAUAAAAUGAGGGCAGUAAGAC Click to Show/Hide
Ensembl ID	ENSG00000266423
HGNC ID	HGNC:38209
Mature Accession	MIMAT0015037
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

5 drug(s) in total

Click to Show/Hide the Full List of Drugs

Carboplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Retinoblastoma				[1]
Sensitive Disease	Retinoblastoma [ICD-11: 2D02.2]			Disease Info
Sensitive Drug	Carboplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	WERI-Rb-1 cells	Retina	Homo sapiens (Human)	CVCL_1792
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	Silencing of ABCG2 by MicroRNA-3163 inhibits multidrug resistance in retinoblastoma cancer stem cells.

Cisplatin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Retinoblastoma				[1]
Sensitive Disease	Retinoblastoma [ICD-11: 2D02.2]			Disease Info
Sensitive Drug	Cisplatin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	WERI-Rb-1 cells	Retina	Homo sapiens (Human)	CVCL_1792
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	Silencing of ABCG2 by MicroRNA-3163 inhibits multidrug resistance in retinoblastoma cancer stem cells.

Doxorubicin

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Retinoblastoma				[1]
Sensitive Disease	Retinoblastoma [ICD-11: 2D02.2]			Disease Info
Sensitive Drug	Doxorubicin			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	WERI-Rb-1 cells	Retina	Homo sapiens (Human)	CVCL_1792
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	Silencing of ABCG2 by MicroRNA-3163 inhibits multidrug resistance in retinoblastoma cancer stem cells.

Etoposide

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Retinoblastoma				[1]
Sensitive Disease	Retinoblastoma [ICD-11: 2D02.2]			Disease Info
Sensitive Drug	Etoposide			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	WERI-Rb-1 cells	Retina	Homo sapiens (Human)	CVCL_1792
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	Silencing of ABCG2 by MicroRNA-3163 inhibits multidrug resistance in retinoblastoma cancer stem cells.

Vincristine

Click to Show/Hide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Retinoblastoma				[1]
Sensitive Disease	Retinoblastoma [ICD-11: 2D02.2]			Disease Info
Sensitive Drug	Vincristine			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
Cell Pathway Regulation	Cell apoptosis		Activation	hsa04210
	Cell proliferation		Inhibition	hsa05200
In Vitro Model	WERI-Rb-1 cells	Retina	Homo sapiens (Human)	CVCL_1792
Experiment for Molecule Alteration	RT-PCR
Experiment for Drug Resistance	CCK8 assay
Mechanism Description	Silencing of ABCG2 by MicroRNA-3163 inhibits multidrug resistance in retinoblastoma cancer stem cells.

References

Ref 1	Silencing of ABCG2 by MicroRNA-3163 Inhibits Multidrug Resistance in Retinoblastoma Cancer Stem Cells. J Korean Med Sci. 2016 Jun;31(6):836-42. doi: 10.3346/jkms.2016.31.6.836. Epub 2016 Apr 20.