Molecule Information

General Information of the Molecule (ID: Mol01491)

• Name: hsa-mir-335 ,Homo sapiens
• Synonyms: microRNA 335
• Molecule Type: Precursor miRNA
• Gene Name: MIR335
• Gene ID: 442904
• Location: chr7:130496111-130496204[+]
• Sequence:
  UGUUUUGAGCGGGGGUCAAGAGCAAUAACGAAAAAUGUUUGUCAUAAACCGUUUUUCAUU
  AUUGCUCCUGACCUCCUCUCAUUUGCUAUAUUCA
• Ensembl ID: ENSG00000199043
• HGNC ID: HGNC:31773
• Precursor Accession: MI0000816

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 8 drug(s) in total

Cisplatin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung small cell carcinoma [1]

• Sensitive Disease: Lung small cell carcinoma [ICD-11: 2C25.2]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: NF-kappaB signaling pathway; Inhibition; hsa04064
• In Vitro Model: H69 cells; Lung; Homo sapiens (Human); CVCL_8121
• In Vitro Model: H69AR cells; Lung; Homo sapiens (Human); CVCL_3513
• In Vitro Model: H446 cells; Lung; Homo sapiens (Human); CVCL_1562
• In Vitro Model: H446/DDP cells; Lung; Homo sapiens (Human); CVCL_RT21
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Annexin V-PE Apoptosis assay; Flow cytometry assay; Wound healing assay; Colony formation assay
• Mechanism Description: miR335 might affect the chemosensitivity and radiosensitivity of SCLC by targeting PARP-1, which further affected NF-kB P65 protein levels, hence NF-kB pathway was involved in the regulation network.

Cytarabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Acute myeloid leukemia [2]

• Resistant Disease: Acute myeloid leukemia [ICD-11: 2A60.0]
• Resistant Drug: Cytarabine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: Cell invasion; Activation; hsa05200
• Cell Pathway Regulation: Cell migration; Activation; hsa04670
• Cell Pathway Regulation: Cell proliferation; Activation; hsa05200
• Cell Pathway Regulation: Nodal/TFG-alpha signaling pathway; Regulation; hsa04350
• Cell Pathway Regulation: Wnt/alpha -catenin signaling pathway; Regulation; hsa04310
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: Relapse-free survival and overall survival assay
• Mechanism Description: The expression levels of miR-335 in bone marrow and serum samples from adult patients with AML (except M3) were significantly associated with the Ara-C-based chemotherapy response and clinical outcome after treatment.

Doxorubicin

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung small cell carcinoma [1]

• Sensitive Disease: Lung small cell carcinoma [ICD-11: 2C25.2]
• Sensitive Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: NF-kappaB signaling pathway; Inhibition; hsa04064
• In Vitro Model: H69 cells; Lung; Homo sapiens (Human); CVCL_8121
• In Vitro Model: H69AR cells; Lung; Homo sapiens (Human); CVCL_3513
• In Vitro Model: H446 cells; Lung; Homo sapiens (Human); CVCL_1562
• In Vitro Model: H446/DDP cells; Lung; Homo sapiens (Human); CVCL_RT21
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Annexin V-PE Apoptosis assay; Flow cytometry assay; Wound healing assay; Colony formation assay
• Mechanism Description: Overexpression of miR335 sensitized human SCLC cells to chemotherapy and radiotherapy, promoted cell apoptosis and inhibited cell migration ability of human SCLC in vitro, and inhibited tumor growth in vivo. Overexpression of miR335 decreased the expression of PARP-1 mRNA and protein, and NF-kB protein levels were correspondingly downregulated, thus regulating the chemo-radiosensitivity of SCLC.

Etoposide

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung small cell carcinoma [1]

• Sensitive Disease: Lung small cell carcinoma [ICD-11: 2C25.2]
• Sensitive Drug: Etoposide
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: NF-kappaB signaling pathway; Inhibition; hsa04064
• In Vitro Model: H69 cells; Lung; Homo sapiens (Human); CVCL_8121
• In Vitro Model: H69AR cells; Lung; Homo sapiens (Human); CVCL_3513
• In Vitro Model: H446 cells; Lung; Homo sapiens (Human); CVCL_1562
• In Vitro Model: H446/DDP cells; Lung; Homo sapiens (Human); CVCL_RT21
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: CCK8 assay; Annexin V-PE Apoptosis assay; Flow cytometry assay; Wound healing assay; Colony formation assay
• Mechanism Description: Overexpression of miR335 sensitized human SCLC cells to chemotherapy and radiotherapy, promoted cell apoptosis and inhibited cell migration ability of human SCLC in vitro, and inhibited tumor growth in vivo. Overexpression of miR335 decreased the expression of PARP-1 mRNA and protein, and NF-kB protein levels were correspondingly downregulated, thus regulating the chemo-radiosensitivity of SCLC.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [3], [4]

• Sensitive Disease: Melanoma [ICD-11: 2C30.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell viability; Inhibition; hsa05200
• Cell Pathway Regulation: miR335/SIAH2/HDAC3 signaling pathway; Regulation; hsa05206
• In Vitro Model: Malme3M cells; Skin; Homo sapiens (Human); CVCL_1438
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay; Trypan blue exclusion assay; Transwell assay
• Mechanism Description: miR-335-mediated increased sensitivity to anti-cancer drugs was associated with its effect on HDAC3 and SIAH2 expression. miR-335 exerted apoptotic effects and inhibited ubiquitination of HDAC3 in anti-cancer drug-resistant cancer cell lines. miR-335 negatively regulated the invasion, migration, and growth rate of cancer cells. The mouse xenograft model showed that miR-335 negatively regulated the tumorigenic potential of cancer cells. The down-regulation of SIAH2 conferred sensitivity to anti-cancer drugs. The results of the study indicated that the miR-335/SIAH2/HDAC3 axis regulates the response to anti-cancer drugs.

Disease Class: Hepatocellular carcinoma [4]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: miR335/SIAH2/HDAC3 signaling pathway; Regulation; hsa05206
• In Vitro Model: SNU387 cells; Liver; Homo sapiens (Human); CVCL_0250
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Trypan blue exclusion assay; Transwell assay
• Mechanism Description: miR-335-mediated increased sensitivity to anti-cancer drugs was associated with its effect on HDAC3 and SIAH2 expression. miR-335 exerted apoptotic effects and inhibited ubiquitination of HDAC3 in anti-cancer drug-resistant cancer cell lines. miR-335 negatively regulated the invasion, migration, and growth rate of cancer cells. The mouse xenograft model showed that miR-335 negatively regulated the tumorigenic potential of cancer cells. The down-regulation of SIAH2 conferred sensitivity to anti-cancer drugs. The results of the study indicated that the miR-335/SIAH2/HDAC3 axis regulates the response to anti-cancer drugs.

Prednisolone

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Paediatric acute lymphocytic leukemia [5]

• Sensitive Disease: Paediatric acute lymphocytic leukemia [ICD-11: 2B33.4]
• Sensitive Drug: Prednisolone
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• Cell Pathway Regulation: Cell apoptosis; Inhibition; hsa04210
• Cell Pathway Regulation: MAPK signaling pathway; Regulation; hsa04010
• Cell Pathway Regulation: NF-kappaB signaling pathway; Regulation; hsa04064
• In Vitro Model: MLL/AF4+ RS4 cells; Blood; Homo sapiens (Human); CVCL_0093
• In Vitro Model: 697 cells; Bone marrow; Homo sapiens (Human); CVCL_0079
• In Vitro Model: Sup-B15 cells; Bone marrow; Homo sapiens (Human); CVCL_0103
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTS assay
• Mechanism Description: MAPk1 is a novel target of MIR335, and that MEk/ERk inhibitor treatment enhanced prednisolone-induced cell death through the activation of BIM (BCL2L11).

Sorafenib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [6]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Sorafenib
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: c-Met/AKT signaling pathway; Inhibition; hsa01521
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: BEL-7404 cells; Liver; Homo sapiens (Human); CVCL_6568
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qRT-PCR; Dual-luciferase reporter assay
• Experiment for Drug Resistance: CCK8 assay; Flow cytometry assay
• Mechanism Description: LncRNA NEAT1 mediates Sora resistance of HCC cells by suppressing miR-335 expression, and disinhibition on c-Met-Akt signaling pathway.

Vinblastine

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [4]

• Sensitive Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Sensitive Drug: Vinblastine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: miR335/SIAH2/HDAC3 signaling pathway; Regulation; hsa05206
• In Vitro Model: SNU387 cells; Liver; Homo sapiens (Human); CVCL_0250
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Trypan blue exclusion assay; Transwell assay
• Mechanism Description: miR-335-mediated increased sensitivity to anti-cancer drugs was associated with its effect on HDAC3 and SIAH2 expression. miR-335 exerted apoptotic effects and inhibited ubiquitination of HDAC3 in anti-cancer drug-resistant cancer cell lines. miR-335 negatively regulated the invasion, migration, and growth rate of cancer cells. The mouse xenograft model showed that miR-335 negatively regulated the tumorigenic potential of cancer cells. The down-regulation of SIAH2 conferred sensitivity to anti-cancer drugs. The results of the study indicated that the miR-335/SIAH2/HDAC3 axis regulates the response to anti-cancer drugs.

Investigative Drug(s) 1 drug(s) in total

Celastrol

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Melanoma [3]

• Sensitive Disease: Melanoma [ICD-11: 2C30.0]
• Sensitive Drug: Celastrol
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell invasion; Inhibition; hsa05200
• Cell Pathway Regulation: Cell migration; Inhibition; hsa04670
• In Vitro Model: SNU387 cells; Liver; Homo sapiens (Human); CVCL_0250
• In Vitro Model: Malme3M cells; Skin; Homo sapiens (Human); CVCL_1438
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-326, which forms a negative feedback regulatory loop with HDAC3, regulates the invasion and the metastatic potential of cancer cells and tumor-induced angiogenesis in response to anti-cancer drugs. miR-200b, miR-217, and miR-335, which form a positive feedback loop with HDAC3, confer sensitivity to anti-cancer drugs. We show that CAGE, reported to form a feedback loop with miR-200b, serves as a downstream target of HDAC3 and miR-326. In this study, we show that the regulation of the miR-326/HDAC3 axis can be employed for the development of anti-cancer therapeutics.

References

• Ref 1: MiR-335 regulates the chemo-radioresistance of small cell lung cancer cells by targeting PARP-1. Gene. 2017 Feb 5;600:9-15. doi: 10.1016/j.gene.2016.11.031. Epub 2016 Nov 19.
• Ref 2: Bone Marrow MicroRNA-335 Level Predicts the Chemotherapy Response and Prognosis of Adult Acute Myeloid Leukemia. Medicine (Baltimore). 2015 Aug;94(33):e0986. doi: 10.1097/MD.0000000000000986.
• Ref 3: miR-326-histone deacetylase-3 feedback loop regulates the invasion and tumorigenic and angiogenic response to anti-cancer drugs. J Biol Chem. 2014 Oct 3;289(40):28019-39. doi: 10.1074/jbc.M114.578229. Epub 2014 Aug 19.
• Ref 4: miR-335 Targets SIAH2 and Confers Sensitivity to Anti-Cancer Drugs by Increasing the Expression of HDAC3. Mol Cells. 2015 Jun;38(6):562-72. doi: 10.14348/molcells.2015.0051. Epub 2015 May 22.
• Ref 5: Deregulated MIR335 that targets MAPK1 is implicated in poor outcome of paediatric acute lymphoblastic leukaemia. Br J Haematol. 2013 Oct;163(1):93-103. doi: 10.1111/bjh.12489. Epub 2013 Jul 25.
• Ref 6: Long noncoding RNA NEAT1 suppresses sorafenib sensitivity of hepatocellular carcinoma cells via regulating miR-335-c-Met. J Cell Physiol. 2019 Apr 1. doi: 10.1002/jcp.27567. Online ahead of print.