Molecule Information

General Information of the Molecule (ID: Mol01453)
Name
hsa-mir-155 ,Homo sapiens
Synonyms
microRNA 155
    Click to Show/Hide
Molecule Type
Precursor miRNA
Gene Name
MIR155
Gene ID
406947
Location
chr21:25573980-25574044[+]
Sequence
CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGACUCCUACAUAUUAGCAUU
AACAG
    Click to Show/Hide
Ensembl ID
ENSG00000283904
HGNC ID
HGNC:31542
Precursor Accession
MI0000681
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
  RTDM: Regulation by the Disease Microenvironment
Drug Resistance Data Categorized by Drug
Approved Drug(s)
8 drug(s) in total
Click to Show/Hide the Full List of Drugs
Arsenic trioxide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [1]
Resistant Disease Lung cancer [ICD-11: 2C25.5]
 Disease Info 
Resistant Drug Arsenic trioxide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
Nrf2 signaling pathway Activation hsa05208
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT Assay
Mechanism Description miR155 mediates arsenic trioxide resistance by activating Nrf2 and suppressing apoptosis in lung cancer cells. miR155 mediated ATO resistance by upregulating the Nrf2 signaling pathway, but downregulating cellular apoptosis in lung cancer cells.
Cisplatin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Colon cancer [2]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell colony Activation hsa05200
Cell viability Activation hsa05200
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
SW620 cells Colon Homo sapiens (Human) CVCL_0547
In Vivo Model miR-155 knockout mouse model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTS assay; Caspase 3 activity assay; Flow cytometry assay
Mechanism Description Overexpression of miR-155 was associated with decreased levels of FOXO3, primarily through inhibiting the expression of FOXO3 to increase colon cancer resistanec to cisplatin.
Disease Class: Colon cancer [3]
Resistant Disease Colon cancer [ICD-11: 2B90.1]
 Disease Info 
Resistant Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
NF-kappaB signaling pathway Activation hsa04064
In Vitro Model HT29 Cells Colon Homo sapiens (Human) CVCL_A8EZ
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Adrenaline increased miR-155 expression in an NFkB dependent manner. HT29 cells overexpressing miR-155 had a higher cell growth rate and more resistance to cisplatin induced apoptosis. In contrast, HT29 cells overexpressing miR-155 inhibitor displayed decreased cell proliferation and sensitivity to cisplatin induced cell death. In summary, our study here revealed that adrenaline-NFkB-miR-155 pathway at least partially contributes to the psychological stress induced proliferation and chemoresistance in HT29 cells.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Lung cancer [4]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description Apaf-1 is a core molecule in the mitochondrial apoptotic pathway, relaying the death signal to the heptameric apoptosome complex to ignite the downstream cascade of caspases. Down-regulation of miR-155 could enhance the sensitivity of A549 cells to cisplatin treatment via restoration of the Apaf-1 pathway.
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Cervical cancer [5]
Sensitive Disease Cervical cancer [ICD-11: 2C77.0]
 Disease Info 
Sensitive Drug Cisplatin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Activation hsa04210
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model Caski cells Uterus Homo sapiens (Human) CVCL_1100
Experiment for
Molecule Alteration		 RT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description miR155 reversed EGF-induced EMT by downregulating SMAD2 expression levels, and restraining cell growth by inhibiting CCND1 expression, increased the Chemo-sensitivity of Caski Cells to DDP.
Doxorubicin
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Osteosarcoma [6]
Resistant Disease Osteosarcoma [ICD-11: 2B51.0]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell proliferation Activation hsa05200
In Vitro Model MG63 cells Bone marrow Homo sapiens (Human) CVCL_0426
SAOS-2 cells Bone marrow Homo sapiens (Human) CVCL_0548
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qPCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description During treatment with Dox or Cis in osteosarcoma cells, miR-155 expression was strongly induced. The increased miR-155 expression facilitated tumor cell proliferation via upregulating autophagy, thus, facilitated the resistance of osteosarcoma cells to Dox or Cis.
Disease Class: Breast cancer [7]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expressiom
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
TGF-beta/Smad signaling pathway Regulation hsa04350
In Vitro Model Breast cancer cell lines Colon Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration		 qRT-PCR; Northern blotting analysis
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Loss of FOXO3a is often linked to a decline in apoptotic activity and increased chemoresistance in cancer cells. miR-155 directly interacts with 3'-UTR of FOXO3a and blocks FOXO3a translation. knockdown of miR-155 renders cells to apoptosis and enhances chemosensitivity.
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Breast cancer [8]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration		 PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Exosome-mediated breast cancer chemoresistance via miR155 transfeRNA Increased miR155 expression increases miR155 content of exosomes, leading to EMT-associated chemoresistance.
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Multiple myeloma [9]
Sensitive Disease Multiple myeloma [ICD-11: 2A83.0]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model RPMI8226/Dox cells Peripheral blood Homo sapiens (Human) CVCL_0014
RPMI8226/S cells Peripheral blood Homo sapiens (Human) CVCL_0014
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay
Mechanism Description Targeting inhibition of miR155 expression could restore chemotherapy sensitivity by increasing FOXO3a expression in drug-resistant myeloma cells.
Disease Class: Lung cancer [10]
Sensitive Disease Lung cancer [ICD-11: 2C25.5]
 Disease Info 
Sensitive Drug Doxorubicin
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation AKT/ERK signaling pathway Inhibition hsa04010
Cell apoptosis Activation hsa04210
Cell invasion Inhibition hsa05200
Cell migration Inhibition hsa04670
Cell proliferation Inhibition hsa05200
In Vitro Model A549 cells Lung Homo sapiens (Human) CVCL_0023
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Suppression of miR-155 in this cell line considerably reversed doxorubicin resistance, and doxorubicin-induced apoptosis and cell cycle arrest were recovered. Furthermore, reverse transcription-polymerase chain reaction and western blot analysis revealed that miR-155 suppression downregulated the expression of multidrug resistance protein 1, multidrug resistance-associated protein 1, breast cancer resistance protein, glutathione S-transferase-Pi, Survivin and B-cell lymphoma 2, and upregulated the expression of caspase-3 and caspase-8. In addition, it was found that miR-155 suppression inhibited the activation of AkT and extracellular signal-regulated kinase. The transcriptional activity of nuclear factor-kB and activator protein-1 was also downregulated.
Etoposide
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [7]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Etoposide
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
TGF-beta/Smad signaling pathway Regulation hsa04350
In Vitro Model Breast cancer cell lines Colon Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration		 qRT-PCR; Northern blotting analysis
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Loss of FOXO3a is often linked to a decline in apoptotic activity and increased chemoresistance in cancer cells. miR-155 directly interacts with 3'-UTR of FOXO3a and blocks FOXO3a translation. knockdown of miR-155 renders cells to apoptosis and enhances chemosensitivity.
Gemcitabine
Click to Show/Hide
Drug Sensitivity Data Categorized by Their Corresponding Mechanisms
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Pancreatic ductal adenocarcinoma [11]
Sensitive Disease Pancreatic ductal adenocarcinoma [ICD-11: 2C10.0]
 Disease Info 
Sensitive Drug Gemcitabine
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MIA PaCa-2 cells Pancreas Homo sapiens (Human) CVCL_0428
Panc1 cells Pancreas Homo sapiens (Human) CVCL_0480
PSN1 cells Pancreas Homo sapiens (Human) CVCL_1644
In Vivo Model Mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description The increase of miR155 induced two different functions; exosome secretion and chemoresistance ability via facilitating the anti-apoptotic activity.
Paclitaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [7]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
TGF-beta/Smad signaling pathway Regulation hsa04350
In Vitro Model Breast cancer cell lines Colon Homo sapiens (Human) N.A.
Experiment for
Molecule Alteration		 qRT-PCR; Northern blotting analysis
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Loss of FOXO3a is often linked to a decline in apoptotic activity and increased chemoresistance in cancer cells. miR-155 directly interacts with 3'-UTR of FOXO3a and blocks FOXO3a translation. knockdown of miR-155 renders cells to apoptosis and enhances chemosensitivity.
       Regulation by the Disease Microenvironment (RTDM) Click to Show/Hide
Disease Class: Breast cancer [8]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Paclitaxel
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
MDA-MB-231 cells Breast Homo sapiens (Human) CVCL_0062
Experiment for
Molecule Alteration		 PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Exosome-mediated breast cancer chemoresistance via miR155 transfeRNA Increased miR155 expression increases miR155 content of exosomes, leading to EMT-associated chemoresistance.
Tamoxifen
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Breast cancer [12]
Resistant Disease Breast cancer [ICD-11: 2C60.3]
 Disease Info 
Resistant Drug Tamoxifen
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Cell apoptosis Inhibition hsa04210
SOCS6/STAT3 signaling pathway Regulation hsa04630
In Vitro Model MCF-7 cells Breast Homo sapiens (Human) CVCL_0031
SkBR3 cells Breast Homo sapiens (Human) CVCL_0033
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 MTT assay
Mechanism Description Inhibition of miR-155 sensitizes breast cancer cells to tamoxifen and SOCS6 sensitizes the cells to tamoxifen.
Vincristine
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Diffuse large B-cell lymphoma [13]
Resistant Disease Diffuse large B-cell lymphoma [ICD-11: 2A81.0]
 Disease Info 
Resistant Drug Vincristine
 Drug Info 
Molecule Alteration Expression
Down-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model OCI-Ly7 cells N.A. Homo sapiens (Human) CVCL_1881
SU-DHL-5 cells N.A. Homo sapiens (Human) CVCL_1735
Experiment for
Molecule Alteration		 RT-qPCR
Experiment for
Drug Resistance		 Dose-response assays
Mechanism Description Down-regulation of miR-155 promotes vincristine resistance via upregulating Week1.
Investigative Drug(s)
2 drug(s) in total
Click to Show/Hide the Full List of Drugs
NSC141562
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Malignant glioma [14]
Resistant Disease Malignant glioma [ICD-11: 2A00.2]
 Disease Info 
Resistant Drug NSC141562
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Revealed Based on the Cell Line Data
Cell Pathway Regulation Epithelial mesenchymal transition signaling pathway Activation hsa01521
Wnt/beta-catenin signaling pathway Activation hsa04310
In Vitro Model U251 cells Brain Homo sapiens (Human) CVCL_0021
U87 cells Brain Homo sapiens (Human) CVCL_0022
In Vivo Model Nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 CCK8 assay; Wound healing assay; Transwell assay; MTT assay
Mechanism Description miR155HG Is a Mesenchymal Transition-Associated Long Noncoding RNA, miR155-5p and miR155-3p Are key Derivatives of MIR155HG. miR155-5p or miR155-3p Targets Protocadherin 9 or 7, Respectively, Protocadherin 9 and 7 Function as Tumor Suppressor Genes by Inhibiting the Wnt/ beta-catenin signaling pathway.
SL111
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
       Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Mycosis fungoides [15]
Resistant Disease Mycosis fungoides [ICD-11: 2B01.0]
 Disease Info 
Resistant Drug SL111
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MyLa cells Embryo Homo sapiens (Human) N.A.
MJ cells Peripheral blood Homo sapiens (Human) CVCL_1414
In Vivo Model SCID nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description Oncogenic miR-155 appears to contribute to the cancerous phenotype of MyLa and MJ cells.
Disease Class: Mycosis fungoides [15]
Resistant Disease Mycosis fungoides [ICD-11: 2B01.0]
 Disease Info 
Resistant Drug SL111
 Drug Info 
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model MyLa cells Embryo Homo sapiens (Human) N.A.
MJ cells Peripheral blood Homo sapiens (Human) CVCL_1414
In Vivo Model SCID nude mouse xenograft model Mus musculus
Experiment for
Molecule Alteration		 qRT-PCR
Experiment for
Drug Resistance		 Flow cytometry assay
Mechanism Description Oncogenic miR-155 appears to contribute to the cancerous phenotype of MyLa and MJ cells.
References
Ref 1 miR-155 mediates arsenic trioxide resistance by activating Nrf2 and suppressing apoptosis in lung cancer cells. Sci Rep. 2017 Sep 22;7(1):12155. doi: 10.1038/s41598-017-06061-x.
Ref 2 MicroRNA-155 increases colon cancer chemoresistance to cisplatin by targeting forkhead box O3. Oncol Lett. 2018 Apr;15(4):4781-4788. doi: 10.3892/ol.2018.7976. Epub 2018 Feb 7.
Ref 3 Adrenaline promotes cell proliferation and increases chemoresistance in colon cancer HT29 cells through induction of miR-155. Biochem Biophys Res Commun. 2012 Nov 16;428(2):210-5. doi: 10.1016/j.bbrc.2012.09.126. Epub 2012 Oct 1.
Ref 4 MiR-155 inhibits the sensitivity of lung cancer cells to cisplatin via negative regulation of Apaf-1 expression. Cancer Gene Ther. 2012 Nov;19(11):773-8. doi: 10.1038/cgt.2012.60. Epub 2012 Sep 21.
Ref 5 Up-regulated miR155 reverses the epithelial-mesenchymal transition induced by EGF and increases chemo-sensitivity to cisplatin in human Caski cervical cancer cells. PLoS One. 2012;7(12):e52310. doi: 10.1371/journal.pone.0052310. Epub 2012 Dec 20.
Ref 6 miR-155 mediates drug resistance in osteosarcoma cells via inducing autophagy. Exp Ther Med. 2014 Aug;8(2):527-532. doi: 10.3892/etm.2014.1752. Epub 2014 Jun 2.
Ref 7 MicroRNA-155 regulates cell survival, growth, and chemosensitivity by targeting FOXO3a in breast cancer. J Biol Chem. 2010 Jun 4;285(23):17869-79. doi: 10.1074/jbc.M110.101055. Epub 2010 Apr 6.
Ref 8 Exosome-mediated breast cancer chemoresistance via miR-155 transfer. Sci Rep. 2018 Jan 16;8(1):829. doi: 10.1038/s41598-018-19339-5.
Ref 9 [Targeting miR155 restores chemotherapy sensitivity in drug-resistant myeloma cell-line RPMI8226/DOX cells]. Zhonghua Xue Ye Xue Za Zhi. 2017 Jan 14;38(1):55-59. doi: 10.3760/cma.j.issn.0253-2727.2017.01.012.
Ref 10 Effect of miR-155 knockdown on the reversal of doxorubicin resistance in human lung cancer A549/dox cells. Oncol Lett. 2016 Feb;11(2):1161-1166. doi: 10.3892/ol.2015.3995. Epub 2015 Dec 3.
Ref 11 MicroRNA-155 Controls Exosome Synthesis and Promotes Gemcitabine Resistance in Pancreatic Ductal Adenocarcinoma. Sci Rep. 2017 Feb 15;7:42339. doi: 10.1038/srep42339.
Ref 12 MiRNA-155 mediates TAM resistance by modulating SOCS6-STAT3 signalling pathway in breast cancer. Am J Transl Res. 2015 Oct 15;7(10):2115-26. eCollection 2015.
Ref 13 MicroRNA-155 controls vincristine sensitivity and predicts superior clinical outcome in diffuse large B-cell lymphoma. Blood Adv. 2019 Apr 9;3(7):1185-1196. doi: 10.1182/bloodadvances.2018029660.
Ref 14 Blocking MIR155HG/miR-155 axis inhibits mesenchymal transition in glioma. Neuro Oncol. 2017 Sep 1;19(9):1195-1205. doi: 10.1093/neuonc/nox017.
Ref 15 Oncogenic role of microRNA-155 in mycosis fungoides: an in vitro and xenograft mouse model study .Br J Dermatol. 2017 Sep;177(3):791-800. doi: 10.1111/bjd.15422. Epub 2017 May 7. 10.1111/bjd.15422

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Zhang.