Molecule Information

General Information of the Molecule (ID: Mol01441)

• Name: hsa-mir-146a ,Homo sapiens
• Synonyms: microRNA 146a
• Molecule Type: Precursor miRNA
• Gene Name: MIR146A
• Gene ID: 406938
• Location: chr5:160485352-160485450[+]
• Sequence:
  CCGAUGUGUAUCCUCAGCUUUGAGAACUGAAUUCCAUGGGUUGUGUCAGUGUCAGACCUC
  UGAAAUUCAGUUCUUCAGCUGGGAUAUCUCUGUCAUCGU
• Ensembl ID: ENSG00000283733
• HGNC ID: HGNC:31533
• Precursor Accession: MI0000477

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

  RTDM: Regulation by the Disease Microenvironment

Drug Resistance Data Categorized by Drug

Approved Drug(s) 8 drug(s) in total

Carboplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Carboplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Lung cancer [2]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell viability; Activation; hsa05200
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H446 cells; Lung; Homo sapiens (Human); CVCL_1562
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miRNA 146a promotes chemotherapy resistance in lung cancer cells by targeting DNA damage inducible transcript 3 (CHOP).

Disease Class: Lung cancer [3]

• Resistant Disease: Lung cancer [ICD-11: 2C25.5]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: Cytotoxicity detection kit
• Mechanism Description: For human lung cancer cells, RIP1 plays a role in survival. RIP1 knockdown enhanced cytotoxicity induced by the frontline therapeutic drug cisplatin, which is associated with increased miRNA-146a, reduced catalase expression, ROS induction, and degradation of antiapoptotic IAP proteins.

Disease Class: Ovarian cancer [4]

• Resistant Disease: Ovarian cancer [ICD-11: 2C73.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: SkOV3 cells; Ovary; Homo sapiens (Human); CVCL_0532
• In Vitro Model: IGROV1 cells; Ovary; Homo sapiens (Human); CVCL_1304
• Experiment for Molecule Alteration: qPCR
• Experiment for Drug Resistance: WST assay
• Mechanism Description: Higher expression of miR-146a and miR-150 in omental lesions may lead to more aggressive, chemoresistant disease.

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [5]

• Sensitive Disease: Non-small cell lung cancer [ICD-11: 2C25.Y]
• Sensitive Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SPC-A1 cells; Lung; Homo sapiens (Human); CVCL_6955
• In Vitro Model: 293T cells; Breast; Homo sapiens (Human); CVCL_0063
• In Vitro Model: A549/DDP cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: SPC-A1/DDP cells; Kidney; Homo sapiens (Human); CVCL_6955
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-qPCR
• Experiment for Drug Resistance: CCK8 assay; Transwell migration assay; Flow cytometric analysis
• Mechanism Description: Up-regulation of miR146a increases the sensitivity of non-small cell lung cancer to DDP by downregulating cyclin J.

Doxorubicin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Doxorubicin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.

Gemcitabine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Regulation by the Disease Microenvironment (RTDM)

Disease Class: Pancreatic cancer [6]

• Resistant Disease: Pancreatic cancer [ICD-11: 2C10.3]
• Resistant Drug: Gemcitabine
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: MIA PaCa-2 cells; Pancreas; Homo sapiens (Human); CVCL_0428
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: Pancreatic cancers relapse due to small but distinct population of cancer stem cells (CSCs) which are in turn regulated by miRNAs. Those miRNA were either upregulated (e.g. miR-146) or downregulated (e.g. miRNA-205, miRNA-7) in gemcitabine resistant MIA PaCa-2 cancer cells and clinical metastatic pancreatic cancer tissues.

IFN-alpha

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [7]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: IFN-alpha
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Wnt/Beta signaling pathway; Activation; hsa04310
• In Vitro Model: PLC/PRF/5 cells; Liver; Homo sapiens (Human); CVCL_0485
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: miR-146a confers resistance to IFN-alpha in HCC cells by inhibiting apoptosis through SMAD4.

Mitomycin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Mitomycin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.

Paclitaxel

Drug Sensitivity Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Ovarian cancer [8]

• Sensitive Disease: Ovarian cancer [ICD-11: 2C73.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: miR146a/SOD2/ROS signaling pathway; Regulation; hsa05206
• In Vitro Model: HEY cells; Ovary; Homo sapiens (Human); CVCL_0297
• In Vitro Model: OVCAR3 cells; Ovary; Homo sapiens (Human); CVCL_0465
• In Vitro Model: CAOV3 cells; Ovary; Homo sapiens (Human); CVCL_0201
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: CCK8 assay; TUNEL Assay
• Mechanism Description: miR146a downregulates the expression of SOD2 and enhances ROS generation, leading to increased apoptosis, inhibition of proliferation, and enhanced sensitivity to chemotherapy.

Disease Class: Epithelial ovarian cancer [8]

• Sensitive Disease: Epithelial ovarian cancer [ICD-11: 2B5D.0]
• Sensitive Drug: Paclitaxel
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: Cell apoptosis; Activation; hsa04210
• Cell Pathway Regulation: Cell proliferation; Inhibition; hsa05200
• Cell Pathway Regulation: miR146a/SOD2/ROS signaling pathway; Regulation; hsa05206
• In Vitro Model: Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• In Vitro Model: HepG2 cells; Liver; Homo sapiens (Human); CVCL_0027
• In Vitro Model: Hep3B cells; Liver; Homo sapiens (Human); CVCL_0326
• In Vitro Model: PLC cells; Liver; Homo sapiens (Human); CVCL_0485
• In Vivo Model: Nude mouse xenograft model; Mus musculus
• Experiment for Molecule Alteration: RT-PCR
• Experiment for Drug Resistance: MTT assay; CCK8 assay
• Mechanism Description: miR-146a as a potential tumor suppressor in patients with EOC. miR-146a downregulates expression of SOD2 and enhances ROS generation, leading to increased apoptosis, inhibition of proliferation, and (+) sensitivity to chemotherapy.

Vincristine

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Hepatocellular carcinoma [1]

• Resistant Disease: Hepatocellular carcinoma [ICD-11: 2C12.2]
• Resistant Drug: Vincristine
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: HCC Huh-7 cells; Liver; Homo sapiens (Human); CVCL_0336
• Experiment for Molecule Alteration: qRT-PCR
• Experiment for Drug Resistance: MTT assay
• Mechanism Description: The HCC Huh-7 cell line was treated with adramycin (ADM), cisplatin (DDP), carboplatin (CBP), mitomycin C (MMC) or vincristine (VCR) at increasing concentrations to develop drug-resistant sublines. Among these 51 upregulated and downregulated miRNAs, 12 miRNAs were upregulated and 13 miRNAs were downregulated in Huh-7/VCR. Upregulation of miR-27b, miR-181a, miR-146b-5p, miR-181d and miR-146a expression was verified using real-time RT-PCR in the parental and the five drug-resistant cell lines.

References

• Ref 1: Differential miRNA expression profiles in hepatocellular carcinoma cells and drug-resistant sublines. Oncol Rep. 2013 Feb;29(2):555-62. doi: 10.3892/or.2012.2155. Epub 2012 Nov 28.
• Ref 2: miRNA 146a promotes chemotherapy resistance in lung cancer cells by targeting DNA damage inducible transcript 3 (CHOP). Cancer Lett. 2018 Aug 1;428:55-68. doi: 10.1016/j.canlet.2018.04.028. Epub 2018 Apr 24.
• Ref 3: Receptor-interacting protein 1 increases chemoresistance by maintaining inhibitor of apoptosis protein levels and reducing reactive oxygen species through a microRNA-146a-mediated catalase pathway. J Biol Chem. 2014 Feb 28;289(9):5654-63. doi: 10.1074/jbc.M113.526152. Epub 2014 Jan 14.
• Ref 4: Identification of ovarian cancer metastatic miRNAs. PLoS One. 2013;8(3):e58226. doi: 10.1371/journal.pone.0058226. Epub 2013 Mar 12.
• Ref 5: Up-regulation of miR-146a increases the sensitivity of non-small cell lung cancer to DDP by downregulating cyclin J. BMC Cancer. 2017 Feb 15;17(1):138. doi: 10.1186/s12885-017-3132-9.
• Ref 6: miRNA profiling in pancreatic cancer and restoration of chemosensitivity. Cancer Lett. 2013 Jul 1;334(2):211-20. doi: 10.1016/j.canlet.2012.10.008. Epub 2012 Oct 13.
• Ref 7: miR-146a suppresses the sensitivity to interferon-Alpha in hepatocellular carcinoma cells. Biochem Biophys Res Commun. 2011 Nov 4;414(4):675-80. doi: 10.1016/j.bbrc.2011.09.124. Epub 2011 Oct 1.
• Ref 8: miR-146a Inhibits Proliferation and Enhances Chemosensitivity in Epithelial Ovarian Cancer via Reduction of SOD2. Oncol Res. 2016;23(6):275-82. doi: 10.3727/096504016X14562725373798.