Molecule Information
General Information of the Molecule (ID: Mol05889)
| Name |
hsa-miR-659
,Homo sapiens
|
||||
|---|---|---|---|---|---|
| Molecule Type |
Precursor miRNA
|
||||
| Sequence |
UACCGACCCUCGAUUUGGUUCAGGACCUUCCCUGAACCAAGGAAGAGUCACAGUCUCUUC
CUUGGUUCAGGGAGGGUCCCCAACAAUGUCCUCAUGG Click to Show/Hide
|
||||
| Click to Show/Hide the Complete Species Lineage | |||||
Type(s) of Resistant Mechanism of This Molecule
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
| Drug Resistance Data Categorized by Their Corresponding Mechanisms | ||||
|
|
||||
| Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] | [1] | |||
| Resistant Disease | Renal cell carcinoma [ICD-11: 2C90.0] | |||
| Resistant Drug | Sunitinib | |||
| Molecule Alteration | Expression | Up-regulation |
||
| Experimental Note | Identified from the Human Clinical Data | |||
| In Vivo Model | Advanced renal cell carcinoma patients | Homo sapiens | ||
| Experiment for Molecule Alteration |
RT-PCR | |||
| Mechanism Description | Blood samples from 38 patients and 287 miRNAs were evaluated. Twenty-eight miRNAs of the 287 were related to poor response and 23 of the 287 were related to prolonged response to sunitinib treatment. Predictive models identified populations with differences in the established end points. | |||
References
If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.
