Molecule Information

General Information of the Molecule (ID: Mol05889)

• Name: hsa-miR-659 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  UACCGACCCUCGAUUUGGUUCAGGACCUUCCCUGAACCAAGGAAGAGUCACAGUCUCUUC
  CUUGGUUCAGGGAGGGUCCCCAACAAUGUCCUCAUGG

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 1 drug(s) in total

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [1]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vivo Model: Advanced renal cell carcinoma patients; Homo sapiens
• Experiment for Molecule Alteration: RT-PCR
• Mechanism Description: Blood samples from 38 patients and 287 miRNAs were evaluated. Twenty-eight miRNAs of the 287 were related to poor response and 23 of the 287 were related to prolonged response to sunitinib treatment. Predictive models identified populations with differences in the established end points.

References

• Ref 1: VS-5584, a novel and highly selective PI3K/mTOR kinase inhibitor for the treatment of cancerMol Cancer Ther. 2013 Feb;12(2):151-61. doi: 10.1158/1535-7163.MCT-12-0466. Epub 2012 Dec 27.