Molecule Information

General Information of the Molecule (ID: Mol05865)

• Name: hsa-miR-628 ,Homo sapiens
• Molecule Type: Precursor miRNA
• Sequence:
  AUAGCUGUUGUGUCACUUCCUCAUGCUGACAUAUUUACUAGAGGGUAAAAUUAAUAACCU
  UCUAGUAAGAGUGGCAGUCGAAGGGAAGGGCUCAU

Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

  EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s) 4 drug(s) in total

Cisplatin

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Oral squamous cell carcinoma [ICD-11: 2B6E.0] [1]

• Resistant Disease: Oral squamous cell carcinoma [ICD-11: 2B6E.0]
• Resistant Drug: Cisplatin
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: Tca8113 cells; Tongue; Homo sapiens (Human); CVCL_6851
• Experiment for Molecule Alteration: RT-PCR; Western blot
• Experiment for Drug Resistance: Growth inhibition assay
• Mechanism Description: miR-23a is an up-stream regulator of TOP2B to realize the chemoresistance of cisplatin.

Erlotinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Non-small cell lung cancer [ICD-11: 2C25.0] [2]

• Resistant Disease: Non-small cell lung cancer [ICD-11: 2C25.0]
• Resistant Drug: Erlotinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• Cell Pathway Regulation: B-cell development; Regulation; N.A.
• In Vitro Model: A549 cells; Lung; Homo sapiens (Human); CVCL_0023
• In Vitro Model: H460 cells; Lung; Homo sapiens (Human); CVCL_0459
• In Vitro Model: H1975 cells; Lung; Homo sapiens (Human); CVCL_1511
• Experiment for Molecule Alteration: High-throughput miRNA analysis
• Experiment for Drug Resistance: Sulforhodamine-B assay
• Mechanism Description: Expression of 13 miRNA genes predicts response to EGFR inhibition in cancer cell lines and tumours, and discriminates primary from metastatic tumours. Signature genes target proteins that are enriched for epithelial-to-mesenchymal transition (EMT) genes. Epithelial-to-mesenchymal transition predicts EGFR inhibitor resistance and metastatic behaviour. The EMT transcription factor, ZEB1, shows altered expression in erlotinib-sensitive NSCLC and PDAC, where many signature miRNA genes are upregulated. Ectopic expression of mir-200c alters expression of EMT proteins, sensitivity to erlotinib, and migration in lung cells. Treatment with TGFbeta1 changes expression of signature miRNA and EMT proteins and modulates migration in lung cells.

Sunitinib

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Renal cell carcinoma [ICD-11: 2C90.0] [3]

• Resistant Disease: Renal cell carcinoma [ICD-11: 2C90.0]
• Resistant Drug: Sunitinib
• Molecule Alteration: Expression; Up-regulation
• Experimental Note: Identified from the Human Clinical Data
• In Vitro Model: Caki-2 cells; Kidney; Homo sapiens (Human); CVCL_0235
• In Vivo Model: Metastatic Renal Cell Carcinoma patients; Homo sapiens
• Experiment for Molecule Alteration: qRT-PCR; TaqMan low-density arrays; Western blot
• Experiment for Drug Resistance: MTT assay; Co-culture and cell migration assays
• Mechanism Description: High expression of miR-942, miR-628-5p, miR-133a, and miR-484 was significantly associated with decreased time to progression and overall survival. These microRNAs were also overexpressed in the sunitinib resistant cell line Caki-2 in comparison with the sensitive cell line.

Tamoxifen

Drug Resistance Data Categorized by Their Corresponding Mechanisms

Epigenetic Alteration of DNA, RNA or Protein (EADR)

Disease Class: Breast cancer [ICD-11: 2C60.2] [2]

• Resistant Disease: Breast cancer [ICD-11: 2C60.2]
• Resistant Drug: Tamoxifen
• Molecule Alteration: Expression; Down-regulation
• Experimental Note: Revealed Based on the Cell Line Data
• In Vitro Model: MCF-7 cells; Breast; Homo sapiens (Human); CVCL_0031
• In Vitro Model: LCC2 cells; Breast; Homo sapiens (Human); CVCL_DP51
• In Vitro Model: LCC9 cells; Breast; Homo sapiens (Human); CVCL_DP52
• Experiment for Molecule Alteration: Microarray analyses; qPCR; RT-PCR; Western blot
• Mechanism Description: Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

References

• Ref 1: MicroRNAs contribute to the chemoresistance of cisplatin in tongue squamous cell carcinoma lines. Oral Oncol. 2010 Apr;46(4):317-22. doi: 10.1016/j.oraloncology.2010.02.002. Epub 2010 Mar 9.
• Ref 2: PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.
• Ref 3: Novel ATP-competitive MEK inhibitor E6201 is effective against vemurafenib-resistant melanoma harboring the MEK1-C121S mutation in a preclinical modelMol Cancer Ther. 2014 Apr;13(4):823-32. doi: 10.1158/1535-7163.MCT-13-0667. Epub 2014 Jan 21.