General Information of the Molecule (ID: Mol05861)
Name
hsa-miR-598 ,Homo sapiens
Molecule Type
Precursor miRNA
Sequence
GCUUGAUGAUGCUGCUGAUGCUGGCGGUGAUCCCGAUGGUGUGAGCUGGAAAUGGGGUGC
UACGUCAUCGUUGUCAUCGUCAUCAUCAUCAUCCGAG
    Click to Show/Hide
        Click to Show/Hide the Complete Species Lineage
Kingdom: Metazoa
Phylum: Chordata
Class: Mammalia
Order: Primates
Family: Hominidae
Genus: Homo
Species: Homo sapiens
Type(s) of Resistant Mechanism of This Molecule
  EADR: Epigenetic Alteration of DNA, RNA or Protein
Drug Resistance Data Categorized by Drug
Approved Drug(s)
1 drug(s) in total
Click to Show/Hide the Full List of Drugs
Docetaxel
Click to Show/Hide
Drug Resistance Data Categorized by Their Corresponding Mechanisms
  Epigenetic Alteration of DNA, RNA or Protein (EADR) Click to Show/Hide
Disease Class: Prostate cancer [ICD-11: 2C82.0] [1]
Resistant Disease Prostate cancer [ICD-11: 2C82.0]
Resistant Drug Docetaxel
Molecule Alteration Expression
Up-regulation
Experimental Note Identified from the Human Clinical Data
In Vitro Model PC3 cells Prostate Homo sapiens (Human) CVCL_0035
DU145 cells Prostate Homo sapiens (Human) CVCL_0105
Experiment for
Molecule Alteration
qPCR
Mechanism Description Global microRNA profiling was performed on docetaxel-resistant and sensitive cell lines to identify candidate circulating microRNA biomarkers. Custom Taqman Array MicroRNA cards were used to measure the levels of 46 candidate microRNAs in plasma/serum samples, collected before and after docetaxel treatment, from 97 CRPC patients. Expression of hsa-mir-598 is increased.
References
Ref 1 Characterization of the activity of the PI3K/mTOR inhibitor XL765 (SAR245409) in tumor models with diverse genetic alterations affecting the PI3K pathwayMol Cancer Ther. 2014 May;13(5):1078-91. doi: 10.1158/1535-7163.MCT-13-0709. Epub 2014 Mar 14.

If you find any error in data or bug in web service, please kindly report it to Dr. Sun and Dr. Yu.