Molecule Information

General Information of the Molecule (ID: Mol05844)

Name	hsa-miR-549a ,Homo sapiens
Molecule Type	Precursor miRNA
Sequence	AGACAUGCAACUCAAGAAUAUAUUGAGAGCUCAUCCAUAGUUGUCACUGUCUCAAAUCAG UGACAACUAUGGAUGAGCUCUUAAUAUAUCCCAGGC Click to Show/Hide
*Click to Show/Hide the Complete Species Lineage*
Kingdom: Metazoa Phylum: Chordata Class: Mammalia Order: Primates Family: Hominidae Genus: Homo Species: Homo sapiens

Type(s) of Resistant Mechanism of This Molecule

EADR: Epigenetic Alteration of DNA, RNA or Protein

Drug Resistance Data Categorized by Drug

Approved Drug(s)

2 drug(s) in total

Click to Show/Hide the Full List of Drugs

Gemcitabine

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Bladder cancer [ICD-11: 2C94.0]				[1]
Resistant Disease	Bladder cancer [ICD-11: 2C94.0]			Disease Info
Resistant Drug	Gemcitabine			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	J82 cells	Bladder	Homo sapiens (Human)	CVCL_0359
	UM-UC-3 cells	Bladder	Homo sapiens (Human)	CVCL_1783
	RT4 cells	Bladder	Homo sapiens (Human)	CVCL_0036
	RT112 cells	Bladder	Homo sapiens (Human)	CVCL_1670
Experiment for Molecule Alteration	Western blot; Microarray Analysis; qRT-PCR
Experiment for Drug Resistance	Proliferation Assay
Mechanism Description	Within this group, let-7b and let-7i exhibited decreased expression, while miR-1290 and miR-138 displayed increased expression levels in gemcitabine-resistant cells

Tamoxifen

Click to Show/Hide

Drug Resistance Data Categorized by Their Corresponding Mechanisms
Epigenetic Alteration of DNA, RNA or Protein (EADR)			Click to Show/Hide
Disease Class: Breast cancer [ICD-11: 2C60.2]				[2]
Resistant Disease	Breast cancer [ICD-11: 2C60.2]			Disease Info
Resistant Drug	Tamoxifen			Drug Info
Molecule Alteration	Expression		Up-regulation
Experimental Note	Revealed Based on the Cell Line Data
In Vitro Model	MCF-7 cells	Breast	Homo sapiens (Human)	CVCL_0031
	LCC2 cells	Breast	Homo sapiens (Human)	CVCL_DP51
	LCC9 cells	Breast	Homo sapiens (Human)	CVCL_DP52
Experiment for Molecule Alteration	Microarray analyses; qPCR; RT-PCR; Western blot
Mechanism Description	Microarrays identified miRNAs differentially expressed and 4-hydroxytamoxifen (4-OHT) regulated in MCF-7 endocrine- sensitive versus resistant LY2 human breast cancer cells. 97 miRNAs were differentially expressed in MCF-7 versus LY2 cells. Opposite expression of miRs- 10a, 21, 22, 29a, 93, 125b, 181, 200a, 200b, 200c, 205, and 222 was confirmed.

References

Ref 1	The dual pathway inhibitor rigosertib is effective in direct patient tumor xenografts of head and neck squamous cell carcinomasMol Cancer Ther. 2013 Oct;12(10):1994-2005. doi: 10.1158/1535-7163.MCT-13-0206. Epub 2013 Jul 19.
Ref 2	PF-04691502, a potent and selective oral inhibitor of PI3K and mTOR kinases with antitumor activityMol Cancer Ther. 2011 Nov;10(11):2189-99. doi: 10.1158/1535-7163.MCT-11-0185. Epub 2011 Jul 12.